Loading .....

Structure:  NULL
Sequence Organism Notes ID# ID
CR0297 300
Summary for Structure NULL - 1 records total
Structure:  {{{{{{:::::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
GAAATAAAGATAACAGAAAGAACCTTTAT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0074 74
TCGTTATCTGGTCATTGATGGCCAGCAAT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0073 73
GGTGAAACAAGATCCTTCACAACCCACTT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0077 77
TTTTCTCACGAACACCAAGCGGGAAAAGA AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0076 76
TGAACCGAGGAAATGTGCGCTCCACTTGG AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0075 75
Summary for Structure {{{{{{:::::::::::::::::}}}}}} - 5 records total
Structure:  {{{{{{::::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
TCATCTTACCAAATACACCACAAGTAGA AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0072 72
TTCCTAGTGACTCCAACTGTGCAAGGAT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0071 71
GGTCGAGTAACAACTCTTGAGGCCAGCT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0070 70
Summary for Structure {{{{{{::::::::::::::::}}}}}} - 3 records total
Structure:  {{{{{{::::::::}}}}}}
Sequence Organism Notes ID# ID
CCTTAAAATTTGGGGGAATT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0236 236
Summary for Structure {{{{{{::::::::}}}}}} - 1 records total
Structure:  {{{{{{::::::::::::::::::::::::::::::::}}}}
Sequence Organism Notes ID# ID
CAATGTCTTTGATTGGATGCACTTCCTAATTCCGCAATGTTACA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0285 285
ATGATAGTATAGTCTTAGGTATAGGGTAGTCCTACACGTACTAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0284 284
TATCCTCTATAGATGGTATTTTTAGAGAGGGGGACAGGATAGGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0283 283
GTTTTGGGCCAATCAGAATATTAATGAAGTAGATGATGCAAAAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0282 282
CTAAATCTAGATTTGAGTAAGTACCGTAATAATGAACTGATTTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0286 286
GGTCGTGAGCGCGGGAGATCAAGGAATTCACGTGCCGACCAGCA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0281 281
Summary for Structure {{{{{{::::::::::::::::::::::::::::::::}}}} - 6 records total
Structure:  {{{{{{:::::::::::::::::::::::::::::::}}}}
Sequence Organism Notes ID# ID
TTACATGCATGTTAGTGATTATTATAACCCACCACATAATGTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0280 280
CCTTCCTTAATTATTACATGAATCAGATTAAAACACAGGAAGG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0279 279
AATGAGTCAGAAGAATGGACAGCCTATAATTCCTGTCTTACTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0278 278
Summary for Structure {{{{{{:::::::::::::::::::::::::::::::}}}} - 3 records total
Structure:  {{{{{{::::::::::::::::::::::::::::::}}}}
Sequence Organism Notes ID# ID
TAAGATTTGAGTTGGTTATACGGGCTCTTAAAAATAATTCTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0277 277
TAAATATTATTGAGGATGACTTAATACGGTTGCCACATTTAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0276 276
CAACTTGGGTGATCCTGTAACTTCAGGCCTATTTCAGTTGAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0275 275
TATTTGTTTCATGATGTCAATCATTTATTGTTAAAAATAAAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0274 274
TCAGAGCCCGATGATCAGAAAGATGATGATGACGAGAGTCTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0273 273
Summary for Structure {{{{{{::::::::::::::::::::::::::::::}}}} - 5 records total
Structure:  {{{{{{:::::::::::::::::::::::::::::}}}}
Sequence Organism Notes ID# ID
ACACACAAAAAGAAAGAAAAGTTTTTTATACTTTTTGTGTG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0270 272
CCGAGTTCCTCACCGACCACGGCACCAAGCCCTGAGGCTCA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0271 271
GGTTTCAGGTCTAGTTCAGTCTAATTCTAACTGCACCAAAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0272 270
Summary for Structure {{{{{{:::::::::::::::::::::::::::::}}}} - 3 records total
Structure:  {{{{{{::::::::::::::::::::::::::::}}}}
Sequence Organism Notes ID# ID
ATTTTTCAATTCCAAGACGGGAAGGCCCTTGGGCTAAAAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0268 268
ACTCTCATCACACGCTAACTACTAAGGGTTTACCTGAGAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0267 267
CTTAATAGGAACAATGATACTTTCATTCCTACCAGAATTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0269 269
Summary for Structure {{{{{{::::::::::::::::::::::::::::}}}} - 3 records total
Structure:  {{{{{{::::::::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
TATCGATTATGTTGATAATGTAAATAATAGCT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0088 88
CTTAGGAAAGAGCCTATCCTCTACAAGAATCC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0087 87
Summary for Structure {{{{{{::::::::::::::::::::}}}}}} - 2 records total
Structure:  {{{{{{:::::::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
GAATATCCCCCCGAAGGACCAAGTGCTTATA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0086 86
CCCCCATCCTAAGGGTCTCGCAATGGGGGGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0085 85
Summary for Structure {{{{{{:::::::::::::::::::}}}}}} - 2 records total
Structure:  {{{{{{::::::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
AGAATGGACAGCCTATAATTCCTGTCTTAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0079 79
CTAAACTAGTGAATGATTATCTAAGATTTG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0083 83
CCACAACTCTCAGCCATTGCTTTGGGTGTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0078 78
TTATTAGCATCCAAAATGATAAGCAATAAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0082 82
TTTTAAGATAGTTTTAGGAAGTTTAAAATT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0081 81
ATAGACAATCATTAACTATGTTTATATCTG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0080 80
GTGTAAAAACAATATGCAAGGGACCACATT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0084 84
Summary for Structure {{{{{{::::::::::::::::::}}}}}} - 7 records total
Structure:  {{{{{{:::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
GCCTTGTATGACATTAGGTTTCGGAAC AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0065 65
GCCCTCCTCCAAACTGAGATCCGGGAG AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0069 69
TTACTTGCCCCCCCAAGCGTTAATGAA AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0064 64
GTTTGGATCAGGATATTTAATCAAACC AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0068 68
TGTCGTACAATGTGCTCTTCAACAGCA AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0067 67
AGTATATACGATTATTTGTAATCATAT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0066 66
Summary for Structure {{{{{{:::::::::::::::}}}}}} - 6 records total
Structure:  {{{{{{::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
CTTGTAAAATTAAACTACAAGAACAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0060 60
CGACTGCACCACCTGCCTATGCTGAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0059 59
TTTTTCTTTTTCATTGAAGGAAAAAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0063 63
ACAACTATCCCAGGTGGTGTTGTTGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0058 58
GAACCTCCCTGCTTGAGTTTCTTGGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0062 62
AGAATCATTTTCCTGTATGATCTTAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0061 61
Summary for Structure {{{{{{::::::::::::::}}}}}} - 6 records total
Structure:  {{{{{{:::::::::::::}}}}}}
Sequence Organism Notes ID# ID
AAAGATCGGACTCACAGAATTTCTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0056 56
AATTCTATAGAACTTAGGATTAAGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0051 51
AACTTCAGGCCTATTTCAGTTGAAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0055 55
CTTTGAGCGATCAATCTCCGAAACT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0054 54
GTCAAAACAATGTGAGATCCAGTTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0053 53
AAAAAATCTGTATTTTCTCTTTTTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0057 57
ACTTAGGACAAGACCAAGCTGAATC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0052 52
Summary for Structure {{{{{{:::::::::::::}}}}}} - 7 records total
Structure:  {{{{{{::::::::::::}}}}}}
Sequence Organism Notes ID# ID
ATTGTAATAAGACCTCATTAACAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0047 47
TGTTTGTTGATGTTGAAAACAAAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0046 46
ATAATAGCTTTTCCTGTCTATTAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0050 50
TGATTACCTGAGTAATAGACTAAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0045 45
GGTTGATGGATATAGACCCCAACT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0049 49
TTTGATCTGACTGCACTCAAACTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0048 48
Summary for Structure {{{{{{::::::::::::}}}}}} - 6 records total
Structure:  {{{{{{:::::::::::}}}}}}
Sequence Organism Notes ID# ID
AAGGAGATCATAGGCTCTTCCTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0042 42
ACCTTACGAGCAATGTGTGGAAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0043 43
ATAAGATGTTCTTACGATATTCT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0044 44
Summary for Structure {{{{{{:::::::::::}}}}}} - 3 records total
Structure:  {{{{{{::::::::::}}}}}}
Sequence Organism Notes ID# ID
AACTCCCATTTGGGCCTTGAGG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0041 41
AGGAAGGCCATAGATTTCCTTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0040 40
Summary for Structure {{{{{{::::::::::}}}}}} - 2 records total
Structure:  {{{{{{:::::::::}}}}}}
Sequence Organism Notes ID# ID
TCCTATGTTTGGATCAGGATA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0038 38
TCTACAAATTCCATAAGATGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0039 39
AGGACAGAATCATTTTCCTGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0037 37
CAAAAAGAAAGAAAAGTTTTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0034 34
ATTGTACGATAGGGCTAACAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0036 36
GGACAGCCTATAATTCCTGTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0035 35
Summary for Structure {{{{{{:::::::::}}}}}} - 6 records total
Structure:  {{{{{{::::::::}}}}}}
Sequence Organism Notes ID# ID
TTTACATACCAAGCAAATGT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0266 266
TACCACATTAATACATGGTG AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0265 265
Summary for Structure {{{{{{::::::::}}}}}} - 2 records total
Sequence Organism Notes ID# ID
Page summary 79 - records total
Global summary 303 - records total