Compliment Report

Structure:  NULL
Sequence Organism Notes ID# ID
CR0297 300
Summary for Structure NULL - 1 records total
Structure:  {{{{{{:::::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
TCGTTATCTGGTCATTGATGGCCAGCAAT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0073 73
GAAATAAAGATAACAGAAAGAACCTTTAT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0074 74
TGAACCGAGGAAATGTGCGCTCCACTTGG AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0075 75
TTTTCTCACGAACACCAAGCGGGAAAAGA AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0076 76
GGTGAAACAAGATCCTTCACAACCCACTT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0077 77
Summary for Structure {{{{{{:::::::::::::::::}}}}}} - 5 records total
Structure:  {{{{{{::::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
GGTCGAGTAACAACTCTTGAGGCCAGCT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0070 70
TTCCTAGTGACTCCAACTGTGCAAGGAT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0071 71
TCATCTTACCAAATACACCACAAGTAGA AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0072 72
Summary for Structure {{{{{{::::::::::::::::}}}}}} - 3 records total
Structure:  {{{{{{::::::::}}}}}}
Sequence Organism Notes ID# ID
CCTTAAAATTTGGGGGAATT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0236 236
Summary for Structure {{{{{{::::::::}}}}}} - 1 records total
Structure:  {{{{{{::::::::::::::::::::::::::::::::}}}}
Sequence Organism Notes ID# ID
GGTCGTGAGCGCGGGAGATCAAGGAATTCACGTGCCGACCAGCA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0281 281
GTTTTGGGCCAATCAGAATATTAATGAAGTAGATGATGCAAAAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0282 282
TATCCTCTATAGATGGTATTTTTAGAGAGGGGGACAGGATAGGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0283 283
ATGATAGTATAGTCTTAGGTATAGGGTAGTCCTACACGTACTAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0284 284
CAATGTCTTTGATTGGATGCACTTCCTAATTCCGCAATGTTACA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0285 285
CTAAATCTAGATTTGAGTAAGTACCGTAATAATGAACTGATTTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0286 286
Summary for Structure {{{{{{::::::::::::::::::::::::::::::::}}}} - 6 records total
Structure:  {{{{{{:::::::::::::::::::::::::::::::}}}}
Sequence Organism Notes ID# ID
AATGAGTCAGAAGAATGGACAGCCTATAATTCCTGTCTTACTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0278 278
CCTTCCTTAATTATTACATGAATCAGATTAAAACACAGGAAGG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0279 279
TTACATGCATGTTAGTGATTATTATAACCCACCACATAATGTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0280 280

Compliment Report

Summary for Structure {{{{{{:::::::::::::::::::::::::::::::}}}} - 3 records total
Structure:  {{{{{{::::::::::::::::::::::::::::::}}}}
Sequence Organism Notes ID# ID
TCAGAGCCCGATGATCAGAAAGATGATGATGACGAGAGTCTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0273 273
TATTTGTTTCATGATGTCAATCATTTATTGTTAAAAATAAAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0274 274
CAACTTGGGTGATCCTGTAACTTCAGGCCTATTTCAGTTGAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0275 275
TAAATATTATTGAGGATGACTTAATACGGTTGCCACATTTAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0276 276
TAAGATTTGAGTTGGTTATACGGGCTCTTAAAAATAATTCTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0277 277
Summary for Structure {{{{{{::::::::::::::::::::::::::::::}}}} - 5 records total
Structure:  {{{{{{:::::::::::::::::::::::::::::}}}}
Sequence Organism Notes ID# ID
GGTTTCAGGTCTAGTTCAGTCTAATTCTAACTGCACCAAAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0272 270
CCGAGTTCCTCACCGACCACGGCACCAAGCCCTGAGGCTCA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0271 271
ACACACAAAAAGAAAGAAAAGTTTTTTATACTTTTTGTGTG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0270 272
Summary for Structure {{{{{{:::::::::::::::::::::::::::::}}}} - 3 records total
Structure:  {{{{{{::::::::::::::::::::::::::::}}}}
Sequence Organism Notes ID# ID
ACTCTCATCACACGCTAACTACTAAGGGTTTACCTGAGAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0267 267
ATTTTTCAATTCCAAGACGGGAAGGCCCTTGGGCTAAAAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0268 268
CTTAATAGGAACAATGATACTTTCATTCCTACCAGAATTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ... CR0269 269
Summary for Structure {{{{{{::::::::::::::::::::::::::::}}}} - 3 records total
Structure:  {{{{{{::::::::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
CTTAGGAAAGAGCCTATCCTCTACAAGAATCC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0087 87
TATCGATTATGTTGATAATGTAAATAATAGCT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0088 88
Summary for Structure {{{{{{::::::::::::::::::::}}}}}} - 2 records total
Structure:  {{{{{{:::::::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
CCCCCATCCTAAGGGTCTCGCAATGGGGGGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0085 85
GAATATCCCCCCGAAGGACCAAGTGCTTATA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0086 86
Summary for Structure {{{{{{:::::::::::::::::::}}}}}} - 2 records total
Structure:  {{{{{{::::::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
CCACAACTCTCAGCCATTGCTTTGGGTGTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0078 78
AGAATGGACAGCCTATAATTCCTGTCTTAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0079 79
ATAGACAATCATTAACTATGTTTATATCTG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0080 80
Page summary 18 - records total

Compliment Report

TTTTAAGATAGTTTTAGGAAGTTTAAAATT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0081 81
TTATTAGCATCCAAAATGATAAGCAATAAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0082 82
CTAAACTAGTGAATGATTATCTAAGATTTG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0083 83
GTGTAAAAACAATATGCAAGGGACCACATT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0084 84
Summary for Structure {{{{{{::::::::::::::::::}}}}}} - 7 records total
Structure:  {{{{{{:::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
TTACTTGCCCCCCCAAGCGTTAATGAA AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0064 64
GCCTTGTATGACATTAGGTTTCGGAAC AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0065 65
AGTATATACGATTATTTGTAATCATAT AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0066 66
TGTCGTACAATGTGCTCTTCAACAGCA AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0067 67
GTTTGGATCAGGATATTTAATCAAACC AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0068 68
GCCCTCCTCCAAACTGAGATCCGGGAG AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0069 69
Summary for Structure {{{{{{:::::::::::::::}}}}}} - 6 records total
Structure:  {{{{{{::::::::::::::}}}}}}
Sequence Organism Notes ID# ID
ACAACTATCCCAGGTGGTGTTGTTGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0058 58
CGACTGCACCACCTGCCTATGCTGAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0059 59
CTTGTAAAATTAAACTACAAGAACAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0060 60
AGAATCATTTTCCTGTATGATCTTAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0061 61
GAACCTCCCTGCTTGAGTTTCTTGGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0062 62
TTTTTCTTTTTCATTGAAGGAAAAAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0063 63
Summary for Structure {{{{{{::::::::::::::}}}}}} - 6 records total
Structure:  {{{{{{:::::::::::::}}}}}}
Sequence Organism Notes ID# ID
AATTCTATAGAACTTAGGATTAAGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0051 51
ACTTAGGACAAGACCAAGCTGAATC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0052 52
GTCAAAACAATGTGAGATCCAGTTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0053 53
CTTTGAGCGATCAATCTCCGAAACT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0054 54
AACTTCAGGCCTATTTCAGTTGAAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0055 55
AAAGATCGGACTCACAGAATTTCTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0056 56
AAAAAATCTGTATTTTCTCTTTTTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0057 57
Summary for Structure {{{{{{:::::::::::::}}}}}} - 7 records total
Page summary 23 - records total

Compliment Report

Structure:  {{{{{{::::::::::::}}}}}}
Sequence Organism Notes ID# ID
TGATTACCTGAGTAATAGACTAAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0045 45
TGTTTGTTGATGTTGAAAACAAAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0046 46
ATTGTAATAAGACCTCATTAACAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0047 47
TTTGATCTGACTGCACTCAAACTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0048 48
GGTTGATGGATATAGACCCCAACT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0049 49
ATAATAGCTTTTCCTGTCTATTAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0050 50
Summary for Structure {{{{{{::::::::::::}}}}}} - 6 records total
Structure:  {{{{{{:::::::::::}}}}}}
Sequence Organism Notes ID# ID
AAGGAGATCATAGGCTCTTCCTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0042 42
ATAAGATGTTCTTACGATATTCT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0044 44
ACCTTACGAGCAATGTGTGGAAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0043 43
Summary for Structure {{{{{{:::::::::::}}}}}} - 3 records total
Structure:  {{{{{{::::::::::}}}}}}
Sequence Organism Notes ID# ID
AGGAAGGCCATAGATTTCCTTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0040 40
AACTCCCATTTGGGCCTTGAGG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0041 41
Summary for Structure {{{{{{::::::::::}}}}}} - 2 records total
Structure:  {{{{{{:::::::::}}}}}}
Sequence Organism Notes ID# ID
ATTGTACGATAGGGCTAACAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0036 36
AGGACAGAATCATTTTCCTGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0037 37
TCTACAAATTCCATAAGATGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0039 39
TCCTATGTTTGGATCAGGATA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0038 38
GGACAGCCTATAATTCCTGTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0035 35
CAAAAAGAAAGAAAAGTTTTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0034 34
Summary for Structure {{{{{{:::::::::}}}}}} - 6 records total
Structure:  {{{{{{::::::::}}}}}}
Sequence Organism Notes ID# ID
TACCACATTAATACATGGTG AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0265 265
TTTACATACCAAGCAAATGT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0266 266
Summary for Structure {{{{{{::::::::}}}}}} - 2 records total
Page summary 19 - records total

Compliment Report

Structure:  {{{{{{:::::::}}}}}}
Sequence Organism Notes ID# ID
GACAAGTTCCTTGCTGTTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0029 29
GGTGCTCAACACTCCACGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0030 30
TATATGAAGCAGTATATAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0032 32
AAATATTATTAACTTTATA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0031 31
TCAGCTGCGACAAAGTCGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0033 33
AAAATCTAGCTAATTTTAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0028 28
GTGTAGTAGAAGTCACATC AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0252 252
GTGTAGTAGAAGTCACATC AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0253 253
AACGAAACTGGTTTTGCTT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0254 254
TAATGGTAGAAACATTACC AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0255 255
TTATATTCAGCAAAATATA AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0256 256
CTTAAATATTTTTGAATTT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0257 257
AAAATTCTAGCAGTTTTAA AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0258 258
ACATCAGGCATGATGTAGT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0259 259
ACATATGTATATATGTATA AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0260 260
AGTTAAGTTGTTGTCAATT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0261 261
AAGGGAGTTTGTTTTCCCT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0262 262
AGAAAATGGGTTTTCTTTT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0263 263
CCTTGTCAGCAATGGAACA AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0264 264
Summary for Structure {{{{{{:::::::}}}}}} - 19 records total
Structure:  {{{{{{::::::}}}}}}
Sequence Organism Notes ID# ID
GTTTGATGAGAACAAACT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0026 26
TGATTCAGATCCACTAAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0027 27
CCTTCCTACAAGGGAAGG A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0144 144
GGGAGTGGCGAGCCCTCA A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0145 145
CAAGAACCTGTCGTTCTT DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ... CR0179 179
ATATCTTGACGGTATAGA DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0185 185
CTCATTCATTCAGAGTAA DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0187 187
TTAAATTATCTAAATTTA DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0203 203
AACAAAGCTCATTTGTTT DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0209 209
Page summary 28 - records total

Compliment Report

Summary for Structure {{{{{{::::::}}}}}} - 9 records total
Structure:  {{{{{{::::::}}}}}}
Sequence Organism Notes ID# ID
TCTTTTTGTTGCAGAAAA AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0245 245
AAAACCCAGAGGTTTTGG AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0246 246
ATATATTCTTATTATATA AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0247 247
ACAGAGTAAGACTGTCTC AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0248 248
ATTTCAGAAAGTTAAAGT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0249 249
TAATATAATAATATTATA AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0250 250
CTAGGATCAAGTGATCCT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0251 251
Summary for Structure {{{{{{::::::}}}}}} - 7 records total
Structure:  {{{{{{:::::}}}}}}
Sequence Organism Notes ID# ID
TTCTGATTGTAAAGACT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0021 21
TTTATTGTTAAAAATAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0022 22
TTATAAGGTCAAATATT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0023 23
AAATTGCCTTATTTAAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0024 24
AATTCAACCAATTAAGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0025 25
Structure:  {{{{{{:::::}}}}}}
Sequence Organism Notes ID# ID
TTTTAGAAAACAAAATC A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0142 142
GTTTAACATAACAAATT A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0143 143
TTTAAAAGACAAAATTT AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0167 167
ACCAACTTCAATGGTTG AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0168 168
CTTCCGGACTGGAAGGC AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0215 215
CTACCAATGGCGATGGT AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0217 217
GTGCTATCAGCCACGAT AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0219 219
GTGCTATCAGCCACGAT AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0222 222
CTTCCGGACTGGAAGGC AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0223 223
CTACCAATGGCGATGGT AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0224 224
Summary for Structure {{{{{{:::::}}}}}} - 13 records total
Page summary 22 - records total

Compliment Report

CCGTGGTGGCAGGCACC AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0242 242
TTTATATTTGAAAATAT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0243 243
AACTTTCTACTTTGAAA AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0244 244
Summary for Structure {{{{{{:::::}}}}}} - 5 records total
Structure:  {{{{{{::::}}}}}}
Sequence Organism Notes ID# ID
AAAAGAGGGATTTTCT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0016 16
TTTCCATAAGAAAGGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0017 17
AGGATGTTTGTCCTAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0018 18
AATTTCAATTTTAAAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0019 19
CAACTAGGCAGTTGAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0020 20
ATTCTGGACATAAGAC A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0141 141
Structure:  {{{{{{::::}}}}}}
Sequence Organism Notes ID# ID
GTTACTACAGCAATGA A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010 CR0153 153
Summary for Structure {{{{{{::::}}}}}} - 1 records total
TGTGGCGTAGACACCG AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0164 164
CTTATTTGATGAATAA AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0165 165
TTTTAAATTTAAAATT AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0166 166
CTACAAAGAAGATGTT DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ... CR0177 177
TATAACGTCTATATTG DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ... CR0178 178
ACTGATTCTGTGACTA DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0186 186
ATTTGATGGGTAAACT DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ... CR0196 196
CACATTGGCTGTGTAA DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0205 205
Summary for Structure {{{{{{::::}}}}}} - 14 records total
Structure:  {{{{{{:::}}}}}}
Sequence Organism Notes ID# ID
CATTTTCTAGTAAAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0011 11
TGTCCTGCCACAGGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0012 12
TGATTGGTTACTAAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0013 13
TATCCCAAAATAGGG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0014 14
TTAAATTAAAATTTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0015 15
Page summary 23 - records total

Compliment Report

TTGTTTCACAACAAA A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0139 139
ATAGTTATCTATCAA A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0140 140
CCAATTATAGGTTAA A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010 CR0151 151
ACACATGCCTGTGTA A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010 CR0152 152
TCGATGATAAGCTAC AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0163 163
GTTTTTATACAAAAA DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ... CR0175 175
TTTAAATTCAAATTT DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ... CR0176 176
CTCAACATGGAGTTG DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0184 184
ACTTTTTGATGAAAA DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ... CR0195 195
AGTAGTAACTCATCA AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0220 220
AGTAGTAACTCATCA AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0221 221
ATTAACAATTAATTG AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0241 241
Summary for Structure {{{{{{:::}}}}}} - 17 records total
Structure:  {{{{{{::}}}}}}
Sequence Organism Notes ID# ID
CTACTGGTGATGAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0004 4
CTGAGGGAGACTCC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0005 5
AGTTGGTCTCAACC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0006 6
GATGGTATCTACCA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0008 8
ATAGGGAATATCCC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0007 7
TCAAATCTAGTTTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0009 9
AAAAGGCCTTTTCC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0010 10
AGACAACATCTGTT A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0135 135
GTATTTGCCATAAA A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0137 137
AATCAGAGTTAGTC A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0138 138
AATCAGAGTTAGTC A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010 CR0147 147
CTCTAAATGAGATT A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010 CR0148 148
ATGAAACATACTTT AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0162 162
TACATCTGATGTAG DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ... CR0174 174
AGAACTTCTCTTGA DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0183 183
TATTTTAAATAAAA DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ... CR0194 194
Page summary 28 - records total

Compliment Report

TGTTGATTACAACT DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ... CR0202 202
AACTTAATTTGAAT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0237 237
CAGTGAGGGTCACT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0238 238
CCTTTCACGGAAAG AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0240 239
CAGTGAGGGTCACT AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ... CR0239 240
Summary for Structure {{{{{{::}}}}}} - 21 records total
Structure:  {{{{{{:}}}}}}
Sequence Organism Notes ID# ID
CGGGAAGGCCCTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0001 1
GAAAAATCTTTTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0002 2
CGGAGTGGCCTCA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0003 3
CTCCTTAGAGGAA A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0133 133
TTATATAAATATA A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0134 134
TCTGGTTAGACCA A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010 CR0136 136
TCTGGTTAGACCA A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010 CR0146 146
TTATATAAATATA A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010 CR0149 149
TCTGGTTAGACCA A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010 CR0150 150
AACTCCCTTGAGG AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0156 156
AAGTAGGTTCATC AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0157 157
AAGAGTTTTCTCA AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0158 158
TGGTTTAACCAAA AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0159 159
TAGCAGAATCGTC AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0160 160
TAGCAGAATCGTC AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0161 161
TGATGCGACTACG DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0190 190
AATTAATTTAATT DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0193 193
CTATCTGGATAGA DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0204 204
CCCGGATGGGCCT DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0206 206
GCCACCCCGGTGG DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0208 208
Summary for Structure {{{{{{:}}}}}} - 20 records total
Structure:  {{{{{{{:::::::::::::::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
ATAGGAAAACATTATAGCATTAAAACATAAAGTATCCTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0124 124
Page summary 26 - records total

Compliment Report

TTCCCCTGGGATGGTTCCATTGCACATACCAGAAGGGGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0125 125
TTGTGATACTTTGACTATAGGAAATAATTTTCAACACTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0126 126
Summary for Structure {{{{{{{:::::::::::::::::::::::::}}}}}}} - 3 records total
Structure:  {{{{{{{::::::::::::::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
ATATGTCATCTACTCTCCAGAGTATGACCCCTATACAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0122 122
CCAAACCCTCTGCGAAGCATTACTTGCAGATGGTTTGG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0123 123
Summary for Structure {{{{{{{::::::::::::::::::::::::}}}}}}} - 2 records total
Structure:  {{{{{{{:::::::::::::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
GAGTGTACAAGAGATTCTTCAAATGACCCCCTCACAT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0121 121
Summary for Structure {{{{{{{:::::::::::::::::::::::}}}}}}} - 1 records total
Structure:  {{{{{{{::::::::::::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
AAAAAGAGGGATTTTCTCAGGAAAAATCTTTTTTCT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0117 117
CTGTCTTTCGAAGCTTTATCGCTCAACGAGACAGAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0118 118
TACAATGATTAATAAGGAGCCTGTTTAAAATGTTAC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0119 119
TTCTAGGATATGGTGATTATATCTTCTGGAAGATCC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0120 120
Summary for Structure {{{{{{{::::::::::::::::::::::}}}}}}} - 4 records total
Structure:  {{{{{{{:::::::::::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
GGTCATTGATGGCCAGCAATTCCTCTGGCCAGTAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0113 113
AGAAAAAGAGGGATTTTCTCAGGAAAAATCTTTTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0114 114
AATTTAAGCTTGATACATTTCTAGCATTTTAAATT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0115 115
GCTACAATCCCAATAGACTACATTGCTCCGATGTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0116 116
Summary for Structure {{{{{{{:::::::::::::::::::::}}}}}}} - 4 records total
Structure:  {{{{{{{::::::::::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
GTATAACGCAGGAGACTACCTGTTGTCCATATTG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0112 112
Summary for Structure {{{{{{{::::::::::::::::::::}}}}}}} - 1 records total
Structure:  {{{{{{{::::::::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
GAATATCCCCCCGAAGGACCAAGTGCTTATAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0110 110
Summary for Structure {{{{{{{::::::::::::::::::}}}}}}} - 1 records total
Structure:  {{{{{{{:::::::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
CCACAACTCTCAGCCATTGCTTTGGGTGTTG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0108 108
Page summary 16 - records total

Compliment Report

CTAAACTAGTGAATGATTATCTAAGATTTGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0109 109
GTGTAAAAACAATATGCAAGGGACCACATTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0111 111
Summary for Structure {{{{{{{:::::::::::::::::}}}}}}} - 3 records total
Structure:  {{{{{{{::::::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
GAAATAAAGATAACAGAAAGAACCTTTATT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0107 107
Summary for Structure {{{{{{{::::::::::::::::}}}}}}} - 1 records total
Structure:  {{{{{{{::::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
GCCTTGTATGACATTAGGTTTCGGAACA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0105 105
GTTTGGATCAGGATATTTAATCAAACCT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0106 106
Summary for Structure {{{{{{{::::::::::::::}}}}}}} - 2 records total
Structure:  {{{{{{{:::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
AGAATCATTTTCCTGTATGATCTTAGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0103 103
Summary for Structure {{{{{{{:::::::::::::}}}}}}} - 1 records total
Structure:  {{{{{{{:::::::::::::}}}}}}}
Sequence Organism Notes ID# ID
TTTTTCTTTTTCATTGAAGGAAAAAGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0104 104
Summary for Structure {{{{{{{:::::::::::::}}}}}}} - 1 records total
Structure:  {{{{{{{:::::::::::}}}}}}}
Sequence Organism Notes ID# ID
TTTGATCTGACTGCACTCAAACTAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0100 100
Summary for Structure {{{{{{{:::::::::::}}}}}}} - 1 records total
Structure:  {{{{{{{::::::::::}}}}}}}
Sequence Organism Notes ID# ID
ACCTTACGAGCAATGTGTGGAATG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0102 102
Summary for Structure {{{{{{{::::::::::}}}}}}} - 1 records total
Structure:  {{{{{{{:::::::::}}}}}}}
Sequence Organism Notes ID# ID
AACTCCCATTTGGGCCTTGAGGG AY729654 Sudan ebolavirusAY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0101 101
Summary for Structure {{{{{{{:::::::::}}}}}}} - 1 records total
Structure:  {{{{{{{::::::::}}}}}}}
Sequence Organism Notes ID# ID
GGATATTTAATCAAACCTATAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0098 98
TCTACAAATTCCATAAGATGTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0099 99
GGATATTTAATCAAACCTATAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ... CR0232 231
TCTACAAATTCCATAAGATGTT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ... CR0233 234
Page summary 14 - records total

Compliment Report

Summary for Structure {{{{{{{::::::::}}}}}}} - 4 records total
Structure:  {{{{{{{:::::::}}}}}}}
Sequence Organism Notes ID# ID
AGTCAAGAATGAGGTCAGTTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0094 94
CCGTTCTACTTCCAGGCAAGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0095 95
CTTTTTCATTGAAGGAAAAAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0096 96
CTTCTGCAGATCTTGAAGACG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0097 97
Summary for Structure {{{{{{{:::::::}}}}}}} - 4 records total
Structure:  {{{{{{{:::::::}}}}}}}
Sequence Organism Notes ID# ID
CCGTTCTACTTCCAGGCAAGA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ... CR0229 229
CTTTTTCATTGAAGGAAAAAG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ... CR0230 230
CTTCTGCAGATCTTGAAGACG AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ... CR0231 232
Summary for Structure {{{{{{{:::::::}}}}}}} - 3 records total
Structure:  {{{{{{{::::::}}}}}}}
Sequence Organism Notes ID# ID
AAATATTATTAACTTTATAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0093 93
TTTGAAACAACAAAAACTTT DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0192 192
Structure:  {{{{{{{::::::}}}}}}}
Sequence Organism Notes ID# ID
ATGTGACATATACTACACTG DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ... CR0199 199
GACGAAACTTTTACTGCTTT DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ... CR0200 200
Summary for Structure {{{{{{{::::::}}}}}}} - 2 records total
GATTTATTGCTGTCTAAATA DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0213 213
TGCATGATTAAACACGTACT DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0214 214
Summary for Structure {{{{{{{::::::}}}}}}} - 4 records total
Structure:  {{{{{{{:::::}}}}}}}
Sequence Organism Notes ID# ID
CAAGAACCTGTCGTTCTTG DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ... CR0182 182
Summary for Structure {{{{{{{:::::}}}}}}} - 1 records total
Structure:  {{{{{{{:::::}}}}}}}
Sequence Organism Notes ID# ID
AACAAAGCTCATTTGTTTC DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0212 212
Summary for Structure {{{{{{{:::::}}}}}}} - 1 records total
Page summary 15 - records total

Compliment Report

Structure:  {{{{{{{::::}}}}}}}
Sequence Organism Notes ID# ID
TTTAAAAGACAAAATTTT AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0173 173
CTACCAATGGCGATGGTT AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0218 218
CTACCAATGGCGATGGTT AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0226 226
Summary for Structure {{{{{{{::::}}}}}}} - 3 records total
Structure:  {{{{{{{:::}}}}}}}
Sequence Organism Notes ID# ID
AAAAGAGGGATTTTCTC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0091 91
TTTCCATAAGAAAGGTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0092 92
TGTGGCGTAGACACCGC AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0171 171
TTTTAAATTTAAAATTT AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0172 172
ACTGATTCTGTGACTAA DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0191 191
ATTTGATGGGTAAACTA DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ... CR0198 198
Summary for Structure {{{{{{{:::}}}}}}} - 6 records total
Structure:  {{{{{{{::}}}}}}}
Sequence Organism Notes ID# ID
TTTAAATTCAAATTTA DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ... CR0181 181
AGTAGTAACTCATCAT AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0216 216
AGTAGTAACTCATCAT AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0225 225
Summary for Structure {{{{{{{::}}}}}}} - 3 records total
Structure:  {{{{{{{:}}}}}}}
Sequence Organism Notes ID# ID
CTACTGGTGATGACC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0089 89
CTGAGGGAGACTCCC AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0090 90
TACATCTGATGTAGA DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ... CR0180 180
AGAACTTCTCTTGAA DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0189 189
TATTTTAAATAAAAT DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ... CR0197 197
Summary for Structure {{{{{{{:}}}}}}} - 5 records total
Structure:  {{{{{{{{::::::::::::::::::::}}}}}}}}
Sequence Organism Notes ID# ID
GCTACAATCCCAATAGACTACATTGCTCCGATGTTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0132 132
Summary for Structure {{{{{{{{::::::::::::::::::::}}}}}}}} - 1 records total
Structure:  {{{{{{{{:::::::::::::}}}}}}}}
Sequence Organism Notes ID# ID
GTTTGGATCAGGATATTTAATCAAACCTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0129 129
Summary for Structure {{{{{{{{:::::::::::::}}}}}}}} - 1 records total
Page summary 19 - records total

Compliment Report

Structure:  {{{{{{{{::::::::::::}}}}}}}}
Sequence Organism Notes ID# ID
TTTTTCTTTTTCATTGAAGGAAAAAGAA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0130 130
Summary for Structure {{{{{{{{::::::::::::}}}}}}}} - 1 records total
Structure:  {{{{{{{{::::::::}}}}}}}}
Sequence Organism Notes ID# ID
AACTCCCATTTGGGCCTTGAGGGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0128 128
AACTCCCATTTGGGCCTTGAGGGT AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ... CR0235 233
Summary for Structure {{{{{{{{::::::::}}}}}}}} - 2 records total
Structure:  {{{{{{{{:::}}}}}}}}
Sequence Organism Notes ID# ID
CTACCAATGGCGATGGTTA AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0228 228
Summary for Structure {{{{{{{{:::}}}}}}}} - 1 records total
Structure:  {{{{{{{{:}}}}}}}}
Sequence Organism Notes ID# ID
AGTAGTAACTCATCATT AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ... CR0227 227
Summary for Structure {{{{{{{{:}}}}}}}} - 1 records total
Structure:  {{{{{{{{{:::::::}}}}}}}}}
Sequence Organism Notes ID# ID
AACTCCCATTTGGGCCTTGAGGGTA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0131 131
Summary for Structure {{{{{{{{{:::::::}}}}}}}}} - 1 records total
Structure:  {{{{{{{{{}}}}}}}}}
Sequence Organism Notes ID# ID
TTCCAAATCAAGGTTTAG NC_001494 Jaagsiekte sheep retrovirus >gi|9626914|ref|NC_001494.1| Jaagsiekte sheep retrovirus, complete genome 7462 b More ... CR0298 298
Summary for Structure {{{{{{{{{}}}}}}}}} - 1 records total
Structure:  {{{{{{{{}}}}}}}}
Sequence Organism Notes ID# ID
CTACTGGTGATGACCA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ... CR0127 127
CTACTGGTGATGACCA AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ... CR0234 235
Summary for Structure {{{{{{{{}}}}}}}} - 2 records total
Structure:  {{{{{{{}}}}}}}
Sequence Organism Notes ID# ID
AAGTAGGTTCATCC AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0169 169
TGGTTTAACCAAAT AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0170 170
AATTAATTTAATTA DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ... CR0188 188
GCCACCCCGGTGGG DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0210 210
CTATCTGGATAGAC DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0211 211
GTTTTCTCAAAAGA X13063 Turnip yellows virus >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA 5641 bp Jame More ... CR0300 296
Page summary 15 - records total

Compliment Report

GGAGTCCCCTCAGG NC_001514 Squirrel monkey retrovirus >gi|9627014|ref|NC_001514.1| Squirrel monkey retrovirus - HLB, complete genome 8 More ... CR0299 297
AAGTAGGTTCATCC AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus AF218039 9185 bp Jame More ... CR0296 299
Summary for Structure {{{{{{{}}}}}}} - 8 records total
Structure:  {{{{{{}}}}}}
Sequence Organism Notes ID# ID
ACTTTTTGAAAA AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0154 154
TTTACGAAATGC AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ... CR0155 155
ATTGATTAACTA DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ... CR0201 201
ATAGATTATCTA DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ... CR0207 207
AAATCCTTTAGG EU069819 Bandicoot papillomatosis >gi|158699277|gb|EU069819.1| Bandicoot papillomatosis carcinomatosis virus type More ... CR0301 301
TAGATGATCTAC EU069819 Bandicoot papillomatosis >gi|158699277|gb|EU069819.1| Bandicoot papillomatosis carcinomatosis virus type More ... CR0302 302
AAAGAATTTCTT EU069819 Bandicoot papillomatosis >gi|158699277|gb|EU069819.1| Bandicoot papillomatosis carcinomatosis virus type More ... CR0303 303
Summary for Structure {{{{{{}}}}}} - 7 records total
Structure:  {{{{{}}}}}
Sequence Organism Notes ID# ID
CATGGGTACC K03455 HIV 4149...4159 Computational James F. Lynn 09/17/2010 CR0290 287
TAAGAATTCT K03455 HIV 5739...5749 Computational James F. Lynn 09/17/2010 CR0291 288
TGAAGACTTC K03455 HIV 2911...2921 Computational James F. Lynn 09/17/2010 CR0288 289
GGGTGCCCAC K03455 HIV 3622...3632 Computational James F. Lynn 09/17/2010 CR0289 290
AAGACTTCTG K03455 HIV 2802...2812 Computational James F. Lynn 09/17/2010 CR0287 291
TAGTAATCAT K03455 HIV 6134...6144 Computational James F. Lynn 09/17/2010 CR0292 292
TGTACACATG K03455 HIV 6962...6972 Computational James F. Lynn 09/17/2010 CR0293 293
ACATCTGTAG K03455 HIV 7091...7101 Computational James F. Lynn 09/17/2010 CR0294 294
TCCTCAGGAG K03455 HIV 7313...7323 Computational James F. Lynn 09/17/2010 CR0295 295
Summary for Structure {{{{{}}}}} - 9 records total
Page summary 18 - records total
Global summary 303 - records total