Main DB Compliment Repeats, View record [ ID: 74 ]
ID# CR0074 
ID 74 
Sequence GAAATAAAGATAACAGAAAGAACCTTTAT 
Structure {{{{{{:::::::::::::::::}}}}}} 
Organism AY729654 Sudan ebolaviru 
Notes >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Computational 02/13/2010 James F. Lynn