Main DB Compliment Repeats, View record [ ID: 68 ]
ID# CR0068 
ID 68 
Sequence GTTTGGATCAGGATATTTAATCAAACC 
Structure {{{{{{:::::::::::::::}}}}}} 
Organism AY729654 Sudan ebolaviru 
Notes >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Computational 02/13/2010 James F. Lynn