Main DB Compliment Repeats, View record [ ID: 273 ]
ID# CR0273 
ID 273 
Sequence TCAGAGCCCGATGATCAGAAAGATGATGATGACGAGAGTCTC 
Structure {{{{{{::::::::::::::::::::::::::::::}}}} 
Organism AY729654 Sudan ebolavirus 
Notes >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 James F. Lynn Computational 03/20/2010