Main DB Compliment Repeats, View record [ ID: 233 ]
ID# CR0235 
ID 233 
Sequence AACTCCCATTTGGGCCTTGAGGGT 
Structure {{{{{{{{::::::::}}}}}}}} 
Organism AY729654 Sudan ebolavirus 
Notes >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 Computational James F. Lynn 03-08-2010