Main DB Compliment Repeats, View record [ ID: 230 ]
ID# CR0230 
ID 230 
Sequence CTTTTTCATTGAAGGAAAAAG 
Structure {{{{{{{:::::::}}}}}}} 
Organism AY729654 Sudan ebolavirus 
Notes >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 Computational James F. Lynn 03-08-2010