Main DB Compliment Repeats, View record [ ID: 214 ]
ID# CR0214 
ID 214 
Sequence TGCATGATTAAACACGTACT 
Structure {{{{{{{::::::}}}}}}} 
Organism DQ192570 Crow polyomavirus 
Notes >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational James F. Lynn 03-06-2010