Main DB Compliment Repeats, View record [ ID: 200 ]
ID# CR0200 
ID 200 
Sequence GACGAAACTTTTACTGCTTT 
Structure {{{{{{{::::::}}}}}}}  
Organism DQ113899 Adult diarrheal rotavirus  
Notes >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computational James F. Lynn 03-06-2010