Main DB Compliment Repeats, View record [ ID: 199 ]
ID# CR0199 
ID 199 
Sequence ATGTGACATATACTACACTG 
Structure {{{{{{{::::::}}}}}}}  
Organism DQ113899 Adult diarrheal rotavirus  
Notes >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computational James F. Lynn 03-06-2010