Main DB Compliment Repeats, View record [ ID: 192 ]
ID# CR0192 
ID 192 
Sequence TTTGAAACAACAAAAACTTT 
Structure {{{{{{{::::::}}}}}}} 
Organism DQ113898 Adult diarrheal rotavirus 
Notes >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computational James F. Lynn 03-06-2010