Main DB Compliment Repeats, View record [ ID: 119 ]
ID# CR0119 
ID 119 
Sequence TACAATGATTAATAAGGAGCCTGTTTAAAATGTTAC 
Structure {{{{{{{::::::::::::::::::::::}}}}}}} 
Organism AY729654 Sudan ebolavirus 
Notes >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Computational 02/13/2010 James F. Lynn