Main DB Compliment Repeats, View record [ ID: 102 ]
ID# CR0102 
ID 102 
Sequence ACCTTACGAGCAATGTGTGGAATG  
Structure {{{{{{{::::::::::}}}}}}} 
Organism AY729654 Sudan ebolavirus 
Notes >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Computational 02/13/2010 James F. Lynn