Loading .....

Main DB Compliment Repeats
  ID# ID Sequence Structure Organism Notes
  View CR0297 300        
  View CR0287 291 AAGACTTCTG {{{{{}}}}} K03455 HIV 2802...2812 Computational James F. Lynn 09/17/2010
  View CR0288 289 TGAAGACTTC {{{{{}}}}} K03455 HIV 2911...2921 Computational James F. Lynn 09/17/2010
  View CR0289 290 GGGTGCCCAC {{{{{}}}}} K03455 HIV 3622...3632 Computational James F. Lynn 09/17/2010
  View CR0290 287 CATGGGTACC {{{{{}}}}} K03455 HIV 4149...4159 Computational James F. Lynn 09/17/2010
  View CR0291 288 TAAGAATTCT {{{{{}}}}} K03455 HIV 5739...5749 Computational James F. Lynn 09/17/2010
  View CR0292 292 TAGTAATCAT {{{{{}}}}} K03455 HIV 6134...6144 Computational James F. Lynn 09/17/2010
  View CR0293 293 TGTACACATG {{{{{}}}}} K03455 HIV 6962...6972 Computational James F. Lynn 09/17/2010
  View CR0294 294 ACATCTGTAG {{{{{}}}}} K03455 HIV 7091...7101 Computational James F. Lynn 09/17/2010
  View CR0295 295 TCCTCAGGAG {{{{{}}}}} K03455 HIV 7313...7323 Computational James F. Lynn 09/17/2010
  View CR0133 133 CTCCTTAGAGGAA {{{{{{:}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0134 134 TTATATAAATATA {{{{{{:}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0135 135 AGACAACATCTGTT {{{{{{::}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0136 136 TCTGGTTAGACCA {{{{{{:}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0137 137 GTATTTGCCATAAA {{{{{{::}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0138 138 AATCAGAGTTAGTC {{{{{{::}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0139 139 TTGTTTCACAACAAA {{{{{{:::}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0140 140 ATAGTTATCTATCAA {{{{{{:::}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0141 141 ATTCTGGACATAAGAC {{{{{{::::}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0142 142 TTTTAGAAAACAAAATC {{{{{{:::::}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0143 143 GTTTAACATAACAAATT {{{{{{:::::}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0144 144 CCTTCCTACAAGGGAAGG {{{{{{::::::}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0145 145 GGGAGTGGCGAGCCCTCA {{{{{{::::::}}}}}} A04321 HIV >A04321|HIVLAIJ19 Computational James F. Lynn 02-27-2010
  View CR0146 146 TCTGGTTAGACCA {{{{{{:}}}}}} A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010
  View CR0147 147 AATCAGAGTTAGTC {{{{{{::}}}}}} A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010
  View CR0148 148 CTCTAAATGAGATT {{{{{{::}}}}}} A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010
  View CR0149 149 TTATATAAATATA {{{{{{:}}}}}} A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010
  View CR0150 150 TCTGGTTAGACCA {{{{{{:}}}}}} A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010
  View CR0151 151 CCAATTATAGGTTAA {{{{{{:::}}}}}} A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010
  View CR0152 152 ACACATGCCTGTGTA {{{{{{:::}}}}}} A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010
  View CR0153 153 GTTACTACAGCAATGA {{{{{{::::}}}}}} A07108 HIV >A07108|HIV Computational James F. Lynn 02-27-2010
  View CR0301 301 AAATCCTTTAGG {{{{{{}}}}}} EU069819 Bandicoot papillomatosis >gi|158699277|gb|EU069819.1| Bandicoot papillomatosis carcinomatosis virus type More ...
  View CR0302 302 TAGATGATCTAC {{{{{{}}}}}} EU069819 Bandicoot papillomatosis >gi|158699277|gb|EU069819.1| Bandicoot papillomatosis carcinomatosis virus type More ...
  View CR0303 303 AAAGAATTTCTT {{{{{{}}}}}} EU069819 Bandicoot papillomatosis >gi|158699277|gb|EU069819.1| Bandicoot papillomatosis carcinomatosis virus type More ...
  View CR0215 215 CTTCCGGACTGGAAGGC {{{{{{:::::}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0216 216 AGTAGTAACTCATCAT {{{{{{{::}}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0217 217 CTACCAATGGCGATGGT {{{{{{:::::}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0218 218 CTACCAATGGCGATGGTT {{{{{{{::::}}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0219 219 GTGCTATCAGCCACGAT {{{{{{:::::}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0220 220 AGTAGTAACTCATCA {{{{{{:::}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0221 221 AGTAGTAACTCATCA {{{{{{:::}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0222 222 GTGCTATCAGCCACGAT {{{{{{:::::}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0223 223 CTTCCGGACTGGAAGGC {{{{{{:::::}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0224 224 CTACCAATGGCGATGGT {{{{{{:::::}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0225 225 AGTAGTAACTCATCAT {{{{{{{::}}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0226 226 CTACCAATGGCGATGGTT {{{{{{{::::}}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0227 227 AGTAGTAACTCATCATT {{{{{{{{:}}}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0228 228 CTACCAATGGCGATGGTTA {{{{{{{{:::}}}}}}}} AY122286 Melon necrotic spot virus >gi|22022499|gb|AY122286.1| Melon necrotic spot virus isolate Malfa5, complete g More ...
  View CR0267 267 ACTCTCATCACACGCTAACTACTAAGGGTTTACCTGAGAG {{{{{{::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0268 268 ATTTTTCAATTCCAAGACGGGAAGGCCCTTGGGCTAAAAA {{{{{{::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0269 269 CTTAATAGGAACAATGATACTTTCATTCCTACCAGAATTA {{{{{{::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0272 270 GGTTTCAGGTCTAGTTCAGTCTAATTCTAACTGCACCAAAG {{{{{{:::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0271 271 CCGAGTTCCTCACCGACCACGGCACCAAGCCCTGAGGCTCA {{{{{{:::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0270 272 ACACACAAAAAGAAAGAAAAGTTTTTTATACTTTTTGTGTG {{{{{{:::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0273 273 TCAGAGCCCGATGATCAGAAAGATGATGATGACGAGAGTCTC {{{{{{::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0274 274 TATTTGTTTCATGATGTCAATCATTTATTGTTAAAAATAAAC {{{{{{::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0275 275 CAACTTGGGTGATCCTGTAACTTCAGGCCTATTTCAGTTGAA {{{{{{::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0276 276 TAAATATTATTGAGGATGACTTAATACGGTTGCCACATTTAT {{{{{{::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0277 277 TAAGATTTGAGTTGGTTATACGGGCTCTTAAAAATAATTCTA {{{{{{::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0278 278 AATGAGTCAGAAGAATGGACAGCCTATAATTCCTGTCTTACTC {{{{{{:::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0279 279 CCTTCCTTAATTATTACATGAATCAGATTAAAACACAGGAAGG {{{{{{:::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0280 280 TTACATGCATGTTAGTGATTATTATAACCCACCACATAATGTA {{{{{{:::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0281 281 GGTCGTGAGCGCGGGAGATCAAGGAATTCACGTGCCGACCAGCA {{{{{{::::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0282 282 GTTTTGGGCCAATCAGAATATTAATGAAGTAGATGATGCAAAAC {{{{{{::::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0283 283 TATCCTCTATAGATGGTATTTTTAGAGAGGGGGACAGGATAGGA {{{{{{::::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0284 284 ATGATAGTATAGTCTTAGGTATAGGGTAGTCCTACACGTACTAT {{{{{{::::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0285 285 CAATGTCTTTGATTGGATGCACTTCCTAATTCCGCAATGTTACA {{{{{{::::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0286 286 CTAAATCTAGATTTGAGTAAGTACCGTAATAATGAACTGATTTA {{{{{{::::::::::::::::::::::::::::::::}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
  View CR0229 229 CCGTTCTACTTCCAGGCAAGA {{{{{{{:::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ...
  View CR0230 230 CTTTTTCATTGAAGGAAAAAG {{{{{{{:::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ...
  View CR0232 231 GGATATTTAATCAAACCTATAA {{{{{{{::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ...
  View CR0231 232 CTTCTGCAGATCTTGAAGACG {{{{{{{:::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ...
  View CR0235 233 AACTCCCATTTGGGCCTTGAGGGT {{{{{{{{::::::::}}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ...
  View CR0233 234 TCTACAAATTCCATAAGATGTT {{{{{{{::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ...
  View CR0234 235 CTACTGGTGATGACCA {{{{{{{{}}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,875 More ...
  View CR0002 2 GAAAAATCTTTTT {{{{{{:}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0003 3 CGGAGTGGCCTCA {{{{{{:}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0004 4 CTACTGGTGATGAC {{{{{{::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0005 5 CTGAGGGAGACTCC {{{{{{::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0006 6 AGTTGGTCTCAACC {{{{{{::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0008 8 GATGGTATCTACCA {{{{{{::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0007 7 ATAGGGAATATCCC {{{{{{::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0009 9 TCAAATCTAGTTTA {{{{{{::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0010 10 AAAAGGCCTTTTCC {{{{{{::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0011 11 CATTTTCTAGTAAAA {{{{{{:::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0012 12 TGTCCTGCCACAGGA {{{{{{:::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0013 13 TGATTGGTTACTAAC {{{{{{:::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0014 14 TATCCCAAAATAGGG {{{{{{:::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0015 15 TTAAATTAAAATTTA {{{{{{:::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0016 16 AAAAGAGGGATTTTCT {{{{{{::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0017 17 TTTCCATAAGAAAGGT {{{{{{::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0018 18 AGGATGTTTGTCCTAC {{{{{{::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0019 19 AATTTCAATTTTAAAG {{{{{{::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0020 20 CAACTAGGCAGTTGAT {{{{{{::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0021 21 TTCTGATTGTAAAGACT {{{{{{:::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0022 22 TTTATTGTTAAAAATAA {{{{{{:::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0023 23 TTATAAGGTCAAATATT {{{{{{:::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0024 24 AAATTGCCTTATTTAAC {{{{{{:::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0025 25 AATTCAACCAATTAAGT {{{{{{:::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0029 29 GACAAGTTCCTTGCTGTTC {{{{{{:::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0030 30 GGTGCTCAACACTCCACGA {{{{{{:::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0032 32 TATATGAAGCAGTATATAC {{{{{{:::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0031 31 AAATATTATTAACTTTATA {{{{{{:::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0033 33 TCAGCTGCGACAAAGTCGA {{{{{{:::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0026 26 GTTTGATGAGAACAAACT {{{{{{::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0027 27 TGATTCAGATCCACTAAG {{{{{{::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0028 28 AAAATCTAGCTAATTTTAG {{{{{{:::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0036 36 ATTGTACGATAGGGCTAACAT {{{{{{:::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0037 37 AGGACAGAATCATTTTCCTGT {{{{{{:::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0039 39 TCTACAAATTCCATAAGATGT {{{{{{:::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0038 38 TCCTATGTTTGGATCAGGATA {{{{{{:::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0035 35 GGACAGCCTATAATTCCTGTC {{{{{{:::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0034 34 CAAAAAGAAAGAAAAGTTTTT {{{{{{:::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0040 40 AGGAAGGCCATAGATTTCCTTC {{{{{{::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0041 41 AACTCCCATTTGGGCCTTGAGG {{{{{{::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0042 42 AAGGAGATCATAGGCTCTTCCTC {{{{{{:::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0044 44 ATAAGATGTTCTTACGATATTCT {{{{{{:::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0043 43 ACCTTACGAGCAATGTGTGGAAT {{{{{{:::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0045 45 TGATTACCTGAGTAATAGACTAAT {{{{{{::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0046 46 TGTTTGTTGATGTTGAAAACAAAC {{{{{{::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0047 47 ATTGTAATAAGACCTCATTAACAT {{{{{{::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0048 48 TTTGATCTGACTGCACTCAAACTA {{{{{{::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0049 49 GGTTGATGGATATAGACCCCAACT {{{{{{::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0050 50 ATAATAGCTTTTCCTGTCTATTAT {{{{{{::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0051 51 AATTCTATAGAACTTAGGATTAAGA {{{{{{:::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0052 52 ACTTAGGACAAGACCAAGCTGAATC {{{{{{:::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0053 53 GTCAAAACAATGTGAGATCCAGTTT {{{{{{:::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0054 54 CTTTGAGCGATCAATCTCCGAAACT {{{{{{:::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0055 55 AACTTCAGGCCTATTTCAGTTGAAG {{{{{{:::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0056 56 AAAGATCGGACTCACAGAATTTCTA {{{{{{:::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0057 57 AAAAAATCTGTATTTTCTCTTTTTT {{{{{{:::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0058 58 ACAACTATCCCAGGTGGTGTTGTTGA {{{{{{::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0059 59 CGACTGCACCACCTGCCTATGCTGAC {{{{{{::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0060 60 CTTGTAAAATTAAACTACAAGAACAT {{{{{{::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0061 61 AGAATCATTTTCCTGTATGATCTTAG {{{{{{::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0062 62 GAACCTCCCTGCTTGAGTTTCTTGGA {{{{{{::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0063 63 TTTTTCTTTTTCATTGAAGGAAAAAG {{{{{{::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0064 64 TTACTTGCCCCCCCAAGCGTTAATGAA {{{{{{:::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0065 65 GCCTTGTATGACATTAGGTTTCGGAAC {{{{{{:::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0066 66 AGTATATACGATTATTTGTAATCATAT {{{{{{:::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0067 67 TGTCGTACAATGTGCTCTTCAACAGCA {{{{{{:::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0068 68 GTTTGGATCAGGATATTTAATCAAACC {{{{{{:::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0069 69 GCCCTCCTCCAAACTGAGATCCGGGAG {{{{{{:::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0070 70 GGTCGAGTAACAACTCTTGAGGCCAGCT {{{{{{::::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0071 71 TTCCTAGTGACTCCAACTGTGCAAGGAT {{{{{{::::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0072 72 TCATCTTACCAAATACACCACAAGTAGA {{{{{{::::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0073 73 TCGTTATCTGGTCATTGATGGCCAGCAAT {{{{{{:::::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0074 74 GAAATAAAGATAACAGAAAGAACCTTTAT {{{{{{:::::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0075 75 TGAACCGAGGAAATGTGCGCTCCACTTGG {{{{{{:::::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0076 76 TTTTCTCACGAACACCAAGCGGGAAAAGA {{{{{{:::::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0077 77 GGTGAAACAAGATCCTTCACAACCCACTT {{{{{{:::::::::::::::::}}}}}} AY729654 Sudan ebolaviru >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0078 78 CCACAACTCTCAGCCATTGCTTTGGGTGTT {{{{{{::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0079 79 AGAATGGACAGCCTATAATTCCTGTCTTAC {{{{{{::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0080 80 ATAGACAATCATTAACTATGTTTATATCTG {{{{{{::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0081 81 TTTTAAGATAGTTTTAGGAAGTTTAAAATT {{{{{{::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0082 82 TTATTAGCATCCAAAATGATAAGCAATAAT {{{{{{::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0083 83 CTAAACTAGTGAATGATTATCTAAGATTTG {{{{{{::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0084 84 GTGTAAAAACAATATGCAAGGGACCACATT {{{{{{::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0085 85 CCCCCATCCTAAGGGTCTCGCAATGGGGGGT {{{{{{:::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0086 86 GAATATCCCCCCGAAGGACCAAGTGCTTATA {{{{{{:::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0087 87 CTTAGGAAAGAGCCTATCCTCTACAAGAATCC {{{{{{::::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0088 88 TATCGATTATGTTGATAATGTAAATAATAGCT {{{{{{::::::::::::::::::::}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0089 89 CTACTGGTGATGACC {{{{{{{:}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0090 90 CTGAGGGAGACTCCC {{{{{{{:}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0091 91 AAAAGAGGGATTTTCTC {{{{{{{:::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0092 92 TTTCCATAAGAAAGGTA {{{{{{{:::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0093 93 AAATATTATTAACTTTATAA {{{{{{{::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0094 94 AGTCAAGAATGAGGTCAGTTC {{{{{{{:::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0095 95 CCGTTCTACTTCCAGGCAAGA {{{{{{{:::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0096 96 CTTTTTCATTGAAGGAAAAAG {{{{{{{:::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0097 97 CTTCTGCAGATCTTGAAGACG {{{{{{{:::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0098 98 GGATATTTAATCAAACCTATAA {{{{{{{::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0099 99 TCTACAAATTCCATAAGATGTT {{{{{{{::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0100 100 TTTGATCTGACTGCACTCAAACTAG {{{{{{{:::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0101 101 AACTCCCATTTGGGCCTTGAGGG {{{{{{{:::::::::}}}}}}} AY729654 Sudan ebolavirusAY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0102 102 ACCTTACGAGCAATGTGTGGAATG {{{{{{{::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0103 103 AGAATCATTTTCCTGTATGATCTTAGT {{{{{{{:::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0104 104 TTTTTCTTTTTCATTGAAGGAAAAAGA {{{{{{{:::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0105 105 GCCTTGTATGACATTAGGTTTCGGAACA {{{{{{{::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0106 106 GTTTGGATCAGGATATTTAATCAAACCT {{{{{{{::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0107 107 GAAATAAAGATAACAGAAAGAACCTTTATT {{{{{{{::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0108 108 CCACAACTCTCAGCCATTGCTTTGGGTGTTG {{{{{{{:::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0109 109 CTAAACTAGTGAATGATTATCTAAGATTTGA {{{{{{{:::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0110 110 GAATATCCCCCCGAAGGACCAAGTGCTTATAG {{{{{{{::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0111 111 GTGTAAAAACAATATGCAAGGGACCACATTT {{{{{{{:::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0112 112 GTATAACGCAGGAGACTACCTGTTGTCCATATTG {{{{{{{::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0113 113 GGTCATTGATGGCCAGCAATTCCTCTGGCCAGTAA {{{{{{{:::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0114 114 AGAAAAAGAGGGATTTTCTCAGGAAAAATCTTTTT {{{{{{{:::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0115 115 AATTTAAGCTTGATACATTTCTAGCATTTTAAATT {{{{{{{:::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0116 116 GCTACAATCCCAATAGACTACATTGCTCCGATGTT {{{{{{{:::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0117 117 AAAAAGAGGGATTTTCTCAGGAAAAATCTTTTTTCT {{{{{{{::::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0118 118 CTGTCTTTCGAAGCTTTATCGCTCAACGAGACAGAA {{{{{{{::::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0119 119 TACAATGATTAATAAGGAGCCTGTTTAAAATGTTAC {{{{{{{::::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0120 120 TTCTAGGATATGGTGATTATATCTTCTGGAAGATCC {{{{{{{::::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0121 121 GAGTGTACAAGAGATTCTTCAAATGACCCCCTCACAT {{{{{{{:::::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0122 122 ATATGTCATCTACTCTCCAGAGTATGACCCCTATACAG {{{{{{{::::::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0123 123 CCAAACCCTCTGCGAAGCATTACTTGCAGATGGTTTGG {{{{{{{::::::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0124 124 ATAGGAAAACATTATAGCATTAAAACATAAAGTATCCTT {{{{{{{:::::::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0125 125 TTCCCCTGGGATGGTTCCATTGCACATACCAGAAGGGGA {{{{{{{:::::::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0126 126 TTGTGATACTTTGACTATAGGAAATAATTTTCAACACTA {{{{{{{:::::::::::::::::::::::::}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0127 127 CTACTGGTGATGACCA {{{{{{{{}}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0128 128 AACTCCCATTTGGGCCTTGAGGGT {{{{{{{{::::::::}}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0129 129 GTTTGGATCAGGATATTTAATCAAACCTA {{{{{{{{:::::::::::::}}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0130 130 TTTTTCTTTTTCATTGAAGGAAAAAGAA {{{{{{{{::::::::::::}}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0131 131 AACTCCCATTTGGGCCTTGAGGGTA {{{{{{{{{:::::::}}}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0132 132 GCTACAATCCCAATAGACTACATTGCTCCGATGTTA {{{{{{{{::::::::::::::::::::}}}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0001 1 CGGGAAGGCCCTT {{{{{{:}}}}}} AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome Comput More ...
  View CR0236 236 CCTTAAAATTTGGGGGAATT {{{{{{::::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0237 237 AACTTAATTTGAAT {{{{{{::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0238 238 CAGTGAGGGTCACT {{{{{{::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0240 239 CCTTTCACGGAAAG {{{{{{::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0239 240 CAGTGAGGGTCACT {{{{{{::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0241 241 ATTAACAATTAATTG {{{{{{:::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0242 242 CCGTGGTGGCAGGCACC {{{{{{:::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0243 243 TTTATATTTGAAAATAT {{{{{{:::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0244 244 AACTTTCTACTTTGAAA {{{{{{:::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0245 245 TCTTTTTGTTGCAGAAAA {{{{{{::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0246 246 AAAACCCAGAGGTTTTGG {{{{{{::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0247 247 ATATATTCTTATTATATA {{{{{{::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0248 248 ACAGAGTAAGACTGTCTC {{{{{{::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0249 249 ATTTCAGAAAGTTAAAGT {{{{{{::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0250 250 TAATATAATAATATTATA {{{{{{::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0251 251 CTAGGATCAAGTGATCCT {{{{{{::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0252 252 GTGTAGTAGAAGTCACATC {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0253 253 GTGTAGTAGAAGTCACATC {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0254 254 AACGAAACTGGTTTTGCTT {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0255 255 TAATGGTAGAAACATTACC {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0256 256 TTATATTCAGCAAAATATA {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0257 257 CTTAAATATTTTTGAATTT {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0258 258 AAAATTCTAGCAGTTTTAA {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0259 259 ACATCAGGCATGATGTAGT {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0260 260 ACATATGTATATATGTATA {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0261 261 AGTTAAGTTGTTGTCAATT {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0262 262 AAGGGAGTTTGTTTTCCCT {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0263 263 AGAAAATGGGTTTTCTTTT {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0264 264 CCTTGTCAGCAATGGAACA {{{{{{:::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0265 265 TACCACATTAATACATGGTG {{{{{{::::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0266 266 TTTACATACCAAGCAAATGT {{{{{{::::::::}}}}}} AP000545 Homo sapiens >gi|5931523|dbj|AP000545.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Ey More ...
  View CR0300 296 GTTTTCTCAAAAGA {{{{{{{}}}}}}} X13063 Turnip yellows virus >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA 5641 bp Jame More ...
  View CR0174 174 TACATCTGATGTAG {{{{{{::}}}}}} DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
  View CR0175 175 GTTTTTATACAAAAA {{{{{{:::}}}}}} DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
  View CR0176 176 TTTAAATTCAAATTT {{{{{{:::}}}}}} DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
  View CR0177 177 CTACAAAGAAGATGTT {{{{{{::::}}}}}} DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
  View CR0178 178 TATAACGTCTATATTG {{{{{{::::}}}}}} DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
  View CR0179 179 CAAGAACCTGTCGTTCTT {{{{{{::::::}}}}}} DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
  View CR0180 180 TACATCTGATGTAGA {{{{{{{:}}}}}}} DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
  View CR0181 181 TTTAAATTCAAATTTA {{{{{{{::}}}}}}} DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
  View CR0182 182 CAAGAACCTGTCGTTCTTG {{{{{{{:::::}}}}}}} DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
  View CR0183 183 AGAACTTCTCTTGA {{{{{{::}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0184 184 CTCAACATGGAGTTG {{{{{{:::}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0185 185 ATATCTTGACGGTATAGA {{{{{{::::::}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0186 186 ACTGATTCTGTGACTA {{{{{{::::}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0187 187 CTCATTCATTCAGAGTAA {{{{{{::::::}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0188 188 AATTAATTTAATTA {{{{{{{}}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0189 189 AGAACTTCTCTTGAA {{{{{{{:}}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0190 190 TGATGCGACTACG {{{{{{:}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0191 191 ACTGATTCTGTGACTAA {{{{{{{:::}}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0192 192 TTTGAAACAACAAAAACTTT {{{{{{{::::::}}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0193 193 AATTAATTTAATT {{{{{{:}}}}}} DQ113898 Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computatio More ...
  View CR0194 194 TATTTTAAATAAAA {{{{{{::}}}}}} DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ...
  View CR0195 195 ACTTTTTGATGAAAA {{{{{{:::}}}}}} DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ...
  View CR0196 196 ATTTGATGGGTAAACT {{{{{{::::}}}}}} DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ...
  View CR0197 197 TATTTTAAATAAAAT {{{{{{{:}}}}}}} DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ...
  View CR0198 198 ATTTGATGGGTAAACTA {{{{{{{:::}}}}}}} DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ...
  View CR0199 199 ATGTGACATATACTACACTG {{{{{{{::::::}}}}}}} DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ...
  View CR0200 200 GACGAAACTTTTACTGCTTT {{{{{{{::::::}}}}}}} DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ...
  View CR0201 201 ATTGATTAACTA {{{{{{}}}}}} DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ...
  View CR0202 202 TGTTGATTACAACT {{{{{{::}}}}}} DQ113899 Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computatio More ...
  View CR0203 203 TTAAATTATCTAAATTTA {{{{{{::::::}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0204 204 CTATCTGGATAGA {{{{{{:}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0205 205 CACATTGGCTGTGTAA {{{{{{::::}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0206 206 CCCGGATGGGCCT {{{{{{:}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0207 207 ATAGATTATCTA {{{{{{}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0208 208 GCCACCCCGGTGG {{{{{{:}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0209 209 AACAAAGCTCATTTGTTT {{{{{{::::::}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0210 210 GCCACCCCGGTGGG {{{{{{{}}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0211 211 CTATCTGGATAGAC {{{{{{{}}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0212 212 AACAAAGCTCATTTGTTTC {{{{{{{:::::}}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0213 213 GATTTATTGCTGTCTAAATA {{{{{{{::::::}}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0214 214 TGCATGATTAAACACGTACT {{{{{{{::::::}}}}}}} DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Ja More ...
  View CR0296 299 AAGTAGGTTCATCC {{{{{{{}}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus AF218039 9185 bp Jame More ...
  View CR0154 154 ACTTTTTGAAAA {{{{{{}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0155 155 TTTACGAAATGC {{{{{{}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0156 156 AACTCCCTTGAGG {{{{{{:}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0157 157 AAGTAGGTTCATC {{{{{{:}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0158 158 AAGAGTTTTCTCA {{{{{{:}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0159 159 TGGTTTAACCAAA {{{{{{:}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0160 160 TAGCAGAATCGTC {{{{{{:}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0161 161 TAGCAGAATCGTC {{{{{{:}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0162 162 ATGAAACATACTTT {{{{{{::}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0163 163 TCGATGATAAGCTAC {{{{{{:::}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0164 164 TGTGGCGTAGACACCG {{{{{{::::}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0165 165 CTTATTTGATGAATAA {{{{{{::::}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0166 166 TTTTAAATTTAAAATT {{{{{{::::}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0167 167 TTTAAAAGACAAAATTT {{{{{{:::::}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0168 168 ACCAACTTCAATGGTTG {{{{{{:::::}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0169 169 AAGTAGGTTCATCC {{{{{{{}}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0170 170 TGGTTTAACCAAAT {{{{{{{}}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0171 171 TGTGGCGTAGACACCGC {{{{{{{:::}}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0172 172 TTTTAAATTTAAAATTT {{{{{{{:::}}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0173 173 TTTAAAAGACAAAATTTT {{{{{{{::::}}}}}}} AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James More ...
  View CR0298 298 TTCCAAATCAAGGTTTAG {{{{{{{{{}}}}}}}}} NC_001494 Jaagsiekte sheep retrovirus >gi|9626914|ref|NC_001494.1| Jaagsiekte sheep retrovirus, complete genome 7462 b More ...
  View CR0299 297 GGAGTCCCCTCAGG {{{{{{{}}}}}}} NC_001514 Squirrel monkey retrovirus >gi|9627014|ref|NC_001514.1| Squirrel monkey retrovirus - HLB, complete genome 8 More ...