Loading .....
Logged on as Guest
Log out
Groups per page: 
Structure:  NULL
Sequence Organism ID# ID Notes
RP0648 648
Summary for Structure NULL - 1 records total
Structure:  (((((((((((::(((:::[[[[[)))::))))::::)))))))::::::::::]]]]]
Sequence Organism ID# ID Notes
CCTCTCTCCCTAGCCTCCGCTCTTAGGACGGGGATCAAGAGAGGTCAAACCCAAAAGAG U68074 E.coli RP0175 175 PKB-number: PKB50 Definition: Pseudoknot PK2 of E.coli tmRNA Organism: E.coli More ...
Summary for Structure (((((((((((::(((:::[[[[[)))::))))::::)))))))::::::::::]]]]] - 1 records total
Structure:  ((((((((((:(((:[[[:[[[))):)))))))))):::::::::]]]:]]]
Sequence Organism ID# ID Notes
GTTTGTTAGTGGCGTGTCCGTCCGCAGCTGGCAAGCGAATGTAAAGACTGAC U68074 E.coli RP0177 177 PKB-number: PKB52 Definition: Pseudoknot PK4 of E.coli tmRNA Organism: E.coli More ...
Summary for Structure ((((((((((:(((:[[[:[[[))):)))))))))):::::::::]]]:]]] - 1 records total
Structure:  ((((((((((::::::::[[[[[[[[[::::))))))))))::::]]]]]]]]]
Sequence Organism ID# ID Notes
AAAATGTAAATATTATTTCATTTTTAACTGCTTTGCGTTTTATGTTTAAAGGTG NC_016157 Human papillomavirus RP0664 664 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((((((::::::::[[[[[[[[[::::))))))))))::::]]]]]]]]] - 1 records total
Structure:  ((((((((((:[[[[)))))))))):::::]]]]
Sequence Organism ID# ID Notes
GGGGTAATAACTTGTTTGTTACCTTTTTGGATAA NC_016157 Human papillomavirus RP0672 672 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((((((:[[[[)))))))))):::::]]]] - 1 records total
Structure:  (((((((((::[[[[)))))))))::]]]]
Sequence Organism ID# ID Notes
GTTATCTATCAATACATGGATGATTTGTAT HIV K03455 RP0598 598 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((((::[[[[)))))))))::]]]] - 1 records total
Structure:  (((((((((:[[[[[::::::)))))))))::::]]]]]
Sequence Organism ID# ID Notes
GGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTC HIV K03455 RP0590 590 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((((:[[[[[::::::)))))))))::::]]]]] - 1 records total
Structure:  (((((((((:[[[[[[))))))))):::::::::::::::::::]]]]]]
Sequence Organism ID# ID Notes
AATAAGAGGCTTTGTATCTCTTATTGAATCTTTAGTAATAGGCATACAAA C. botulinum NC_010520 RP0657 657 viral read though like KSPOS J.Lynn 04/19/2011
Summary for Structure (((((((((:[[[[[[))))))))):::::::::::::::::::]]]]]] - 1 records total
Structure:  ((((((((:::[[)))))))):::::]]
Sequence Organism ID# ID Notes
TGGTGCTACAAGCTAGTACCAGTTGAGC HIV K03455 RP0576 576 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
TGGTGCTACAAGCTAGTACCAGTTGAGC HIV K03455 RP0631 631 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((((:::[[)))))))):::::]] - 2 records total
Structure:  ((((((((::[[[[[:::::::::::::))))))))::]]]]]
Sequence Organism ID# ID Notes
GGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGAC HIV K03455 RP0618 618 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((((::[[[[[:::::::::::::))))))))::]]]]] - 1 records total
Structure:  ((((((((::[[[[[[[)))))))):::::::::::::::::]]]]]]]
Sequence Organism ID# ID Notes
GGGTTCGGACCCCCTCCCCGAACCTAGGGTAACACTGACTGUGGAGGGG M26927 gibbon ape leukemia virus RP0209 209 PKB-number: PKB79
Definition: Gag/pol translational readthrough site of gibbo More ...
Summary for Structure ((((((((::[[[[[[[)))))))):::::::::::::::::]]]]]]] - 1 records total
Structure:  ((((((((::[[[[[[[)))))))):::::::::::::]]]]]]]
Sequence Organism ID# ID Notes
AATTACTTTTATTATTTAAGTAATTTGGCTTTTTATATAAATAAT C. botulinum NC_010520 RP0658 658 viral read though like KSPOS J.Lynn 04/19/2011
Summary for Structure ((((((((::[[[[[[[)))))))):::::::::::::]]]]]]] - 1 records total
Structure:  ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]]
Sequence Organism ID# ID Notes
GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGC AF033811 Moloney murine leukemia virus RP0172 172 PKB-number: PKB47 Definition: Gag/pol translational readthrough site of Molone More ...
GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCACTGTCGGGGGGC J01998 AKV murine leukemia virus RP0208 208 PKB-number: PKB78
Definition: Gag/pol translational readthrough site of AKV m More ...
Summary for Structure ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]] - 2 records total
Structure:  (((((((:::::::::::[[[[))))))):::]]]]
Sequence Organism ID# ID Notes
GTCAACATAATTGGAAGAAATCTGTTGACTCAGATT HIV K03455 RP0594 594 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((:::::::::::[[[[))))))):::]]]] - 1 records total
Structure:  (((((((::::::[[[[[[[[))))))):::::::::::::::::]]]]]]]]
Sequence Organism ID# ID Notes
TCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGG HIV K03455 RP0612 612 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::::::[[[[[[[[))))))):::::::::::::::::]]]]]]]] - 1 records total
Structure:  (((((((:::::[[[:)))))))::]]]
Sequence Organism ID# ID Notes
CTTGCTGAAGCGCGCACGGCAAGAGGCG HIV K03455 RP0581 581 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((:::::[[[:)))))))::]]] - 1 records total
Structure:  (((((((::::[[[[((((:::::((((((((:::::))))))))))))))))))):::::::]]]]
Sequence Organism ID# ID Notes
TGTGTCTTGGATCGCGCGGGTCAAATGTATATGGTTCATATACATCCGCAGGCACGTAATAAAGCGA J02415 tobacco mosaic virus RP0182 182 PKB-number: PKB57 Definition: tRNA-like structure bulge pseudoknot of tobacco More ...
Summary for Structure (((((((::::[[[[((((:::::((((((((:::::))))))))))))))))))):::::::]]]] - 1 records total
Structure:  (((((((::::[[[[[)))))))::]]]]]
Sequence Organism ID# ID Notes
TGTTCCTTGGGTTCTTGGGAGCAGCAGGAA HIV K03455 RP0621 621 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::::[[[[[)))))))::]]]]] - 1 records total
Structure:  (((((((::::[[[[[[::)))))))::::::::]]]]]]
Sequence Organism ID# ID Notes
AGTGGGTCTCTAGGGGCACACCCACTACCCGCCGGCCCCT AF033818 Bovine leukemia virus RP0421 421 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
Summary for Structure (((((((::::[[[[[[::)))))))::::::::]]]]]] - 1 records total
Structure:  (((((((::::[[[[[[::::))))))):::::::::::::::::::::::::::::::::::::::]]]]]]
Sequence Organism ID# ID Notes
GTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGG HIV K03455 RP0610 610 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::::[[[[[[::::))))))):::::::::::::::::::::::::::::::::::::::]]]]]] - 1 records total
Structure:  (((((((::[[[))))))):::]]]
Sequence Organism ID# ID Notes
TTGAGAGACTTACTCTTGATTGTAA HIV K03455 RP0624 624 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::[[[))))))):::]]] - 1 records total
Structure:  (((((((::[[[::::))))))):::::::::::]]]
Sequence Organism ID# ID Notes
TTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCT HIV K03455 RP0589 589 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::[[[::::))))))):::::::::::]]] - 1 records total
Structure:  (((((((:[[)))))))::]]
Sequence Organism ID# ID Notes
GGCTTCCTGCGGAAGCCAGGC NC_010317 Abaca bunchy top virus RP0459 459 >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com More ...
Summary for Structure (((((((:[[)))))))::]] - 1 records total
Structure:  ((((((:(::[[[[[[[):))))))::::::::::::::::::]]]]]]]
Sequence Organism ID# ID Notes
GGGTTCTCCCGCCCTCCGTGAACCCAGGCTAAAAGTTAAGGTAGGGGGGC M54993 spleen necrosis virus RP0173 173 PKB-number: PKB48 Definition: Gag/pol translational readthrough site of spleen More ...
Summary for Structure ((((((:(::[[[[[[[):))))))::::::::::::::::::]]]]]]] - 1 records total
Structure:  ((((((:::::::::::::::::[[[[[::::::::))))))::::]]]]]
Sequence Organism ID# ID Notes
TTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCC HIV K03455 RP0629 629 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:::::::::::::::::[[[[[::::::::))))))::::]]]]] - 1 records total
Structure:  ((((((:::::::[[[[:::::)))))):::]]]]
Sequence Organism ID# ID Notes
TGTACAAGATATATACCGTTCATGTGCACAAGGTG NC_016157 Human papillomavirus RP0667 667 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((:::::::[[[[:::::)))))):::]]]] - 1 records total
Structure:  ((((((::::::[[))))))::::]]
Sequence Organism ID# ID Notes
GGGGGGACTTAGCGCCCCCCAAACCG AF033818 Bovine leukemia virus RP0416 416 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
ACTCAGTATTGTGCCTGAGTGATGGC X13063 Turnip yellows virus RP0423 423 >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA Computationa More ...
Summary for Structure ((((((::::::[[))))))::::]] - 2 records total
Structure:  ((((((:::::[[[))))))::::]]]
Sequence Organism ID# ID Notes
GGGGGGACTTAGCGCCCCCCAAACCGT AF033818 Bovine Leukemia Virus RP0080 80 PKB-number: PKB1 Definition: Gag/pro ribosomal frameshift site of Bovine Leuke More ...
ACTCAGTATTGTGCCTGAGTGATGGCA X13063 Turnip yellows virus RP0101 101 >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA12-25-08 Jame More ...
CCACACAAATAATTGTGTGGTCCCAAT Chayote yellow mosaic virus NC_004618 RP0441 441 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu More ...
Summary for Structure ((((((:::::[[[))))))::::]]] - 3 records total
Structure:  ((((((:::::[[[[[:))))))::]]]]]
Sequence Organism ID# ID Notes
CTGGGGATTTGGGGTTGCTCTGGAAAACTC HIV K03455 RP0623 623 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:::::[[[[[:))))))::]]]]] - 1 records total
Structure:  ((((((::::[[[))))))::]]]
Sequence Organism ID# ID Notes
GGCATCACACACAGATGCTGATGT NC_016157 Human papillomavirus RP0669 669 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((::::[[[))))))::]]] - 1 records total
Structure:  ((((((:::[[[[))))))::::::::::::]]]]
Sequence Organism ID# ID Notes
GAGACCTCCAGTGGGTCTCTAGGGGCACACCCACT Bovine Leukemia Virus AF033818 RP0102 102 M0002 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((((:::[[[[)))))) More ...
GGGGCTCAAGGGAGGCCCCAGAAACAAACTTTCCC AF033820 Equine Infectious Anemic Virus RP0082 82 PKB-number: PKB3 Definition: Gag-pol ribosomal frameshift site of Equine Infec More ...
Summary for Structure ((((((:::[[[[))))))::::::::::::]]]] - 2 records total
Structure:  ((((((:::[[[[)))))):::::::::::]]]]
Sequence Organism ID# ID Notes
TTTCAGGTGGCGTCTGAAAAGACTCGCCAGACGC Bovine Leukemia Virus AF033818 RP0103 103 M0003 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((((:::[[[[)))))) More ...
Summary for Structure ((((((:::[[[[)))))):::::::::::]]]] - 1 records total
Structure:  ((((((:::[[[[::))))))::::::::]]]]
Sequence Organism ID# ID Notes
TCCGGGATTGATCACCCCGGAACCCTAACGATC AF033818 Bovine leukemia virus RP0422 422 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
Summary for Structure ((((((:::[[[[::))))))::::::::]]]] - 1 records total
Structure:  ((((((:::[[[[[[[:))))))::]]]]]]]
Sequence Organism ID# ID Notes
GTAGTTTCAGCTTTTGCAGCTGCGACAGAAGT NC_016157 Human papillomavirus RP0662 662 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((:::[[[[[[[:))))))::]]]]]]] - 1 records total
Structure:  ((((((:::[[[[[[[::::::)))))):::]]]]]]]
Sequence Organism ID# ID Notes
AAACATGAGTATGGCAGAATGGGTGTTTAAATGCTGTA NC_016157 Human papillomavirus RP0663 663 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((:::[[[[[[[::::::)))))):::]]]]]]] - 1 records total
Structure:  ((((((:::[[[[[[[[:::::)))))):::::]]]]]]]]
Sequence Organism ID# ID Notes
ACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTG HIV K03455 RP0619 619 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:::[[[[[[[[:::::)))))):::::]]]]]]]] - 1 records total
Structure:  ((((((::[[[[))))))::::::]]]]
Sequence Organism ID# ID Notes
TTCCGGTCGACTCCGGAGAAACAAAGTC L04573 pea enation mosaic virus RP0170 170 PKB-number: PKB45
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymeras More ...
GAGTCCATAATTGGACTCATTCAAAATT Australian bat lyssavirus AF418014 RP0434 434 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
Summary for Structure ((((((::[[[[))))))::::::]]]] - 2 records total
Structure:  ((((((::[[[[[::::)))))):::::::::::::::::::::::::::::::::::::::::::::::::::]]]]]
Sequence Organism ID# ID Notes
TTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGA HIV K03455 RP0596 596 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((::[[[[[::::)))))):::::::::::::::::::::::::::::::::::::::::::::::::::]]]]] - 1 records total
Structure:  ((((((:[[)))))):::]]
Sequence Organism ID# ID Notes
TACAAGGAGCTTGTAGAGCT HIV K03455 RP0626 626 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:[[)))))):::]] - 1 records total
Structure:  ((((((:[[[))))))::::::::::::::::::::::::::::]]]
Sequence Organism ID# ID Notes
CCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGC HIV K03455 RP0614 614 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:[[[))))))::::::::::::::::::::::::::::]]] - 1 records total
Structure:  ((((((:[[[[)))))):::]]]]
Sequence Organism ID# ID Notes
TAACGTTGATAGTGTTGAACTATC U34586 odontoglossum ringspot virus RP0181 181 PKB-number: PKB56 Definition: Pseudoknot PK1 of the upstream pseudoknot domain More ...
Summary for Structure ((((((:[[[[)))))):::]]]] - 1 records total
Structure:  ((((((:[[[[:[[[::::)))))):::::]]]:]]]]
Sequence Organism ID# ID Notes
GAGGATTACTTGAATTACGGAATTCTGAGGAATTCAAG NC_010319 Abaca bunchy top virus RP0457 457 >gi|167006434|ref|NC_010319.1| Abaca bunchy top virus DNA-R, complete genome Com More ...
Summary for Structure ((((((:[[[[:[[[::::)))))):::::]]]:]]]] - 1 records total
Structure:  ((((((:[[[[[[[::::::::::::))))))::::::]]]]]]]
Sequence Organism ID# ID Notes
GGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAG HIV K03455 RP0588 588 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:[[[[[[[::::::::::::))))))::::::]]]]]]] - 1 records total
Structure:  (((((::::::::::::::::::[[[[[::::))))):::::::::::::::::::::::::::::::::::::::::]]]]]
Sequence Organism ID# ID Notes
AAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAG More ... HIV K03455 RP0586 586 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::::::::::::::::[[[[[::::))))):::::::::::::::::::::::::::::::::::::::::]]]]] - 1 records total
Structure:  (((((:::::::::::::::::[[[[[)))))::::::::::::::::::::::::::::::::::]]]]]
Sequence Organism ID# ID Notes
ATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCC HIV K03455 RP0603 603 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:::::::::::::::::[[[[[)))))::::::::::::::::::::::::::::::::::]]]]] - 1 records total
Structure:  (((((::::::::::[[[[[[))))):::::::::::::::::::::::::::::::::::::::]]]]]]
Sequence Organism ID# ID Notes
TCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCT HIV K03455 RP0615 615 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::::::::[[[[[[))))):::::::::::::::::::::::::::::::::::::::]]]]]] - 1 records total
Structure:  (((((::::::::[[[[:))))):::::::::::::]]]]
Sequence Organism ID# ID Notes
GGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTA HIV K03455 RP0602 602 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::::::[[[[:))))):::::::::::::]]]] - 1 records total
Structure:  (((((:::::[[[)))))::::]]]
Sequence Organism ID# ID Notes
AAAGAAATAGCTGTCTTTTATCCAG >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im RP0116 116 M0016
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
GGATTTCTTCAATAATCCCCCCATT NC_009597 Pyrococcus abyssi virus RP0295 295 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
AATTAACAAATTATAATTGGCTTAA AJ577589 Human echovirus 11 RP0329 329 computational-sequence comparison James F. lynn 08-19-2009 >AJ577589 ~7312-7433
GATATTGGAGTGAATATCTTGATCA NC_007193 Chaetoceros salsugineum RP0362 362 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
GGGGGCCGGAGGCCCCCCGGTGGCC NC_001427 Chicken anemia virus RP0377 377 method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke More ...
Summary for Structure (((((:::::[[[)))))::::]]] - 5 records total
Structure:  (((((:::::[[[::)))))::::::::::::]]]
Sequence Organism ID# ID Notes
TAGAGGATCAGCCGACTCTATAAATATAGGGAGGC NC_010317 Abaca bunchy top virus RP0460 460 >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com More ...
GTATTTAAATATTTAAATACCAAACCTTAAGGAAT NC_010315 Abaca bunchy top virus segment 2 RP0462 462 >gi|167006427|ref|NC_010315.1| Abaca bunchy top virus segment 2, complete sequen More ...
TATATTAAATATAACATATAAAATATATAAGGTAT NC_010315 Abaca bunchy top virus segment 2 RP0463 463 >gi|167006427|ref|NC_010315.1| Abaca bunchy top virus segment 2, complete sequen More ...
GCGGCTACCGCAGGTGCCGCGCGAGCGGCGTACTG AF009606 Hepatitis C virus RP0464 464 Computational James F. Lynn 05/30/2010 >gi|2316097|gb|AF009606.1|AF009606 Hepati More ...
TTGAGGAGCTTGCTGCTCAAGAACTAATAGCAGCA AF218039 Cricket paralysis virus RP0465 465 Computational James F. Lynn 05/30/2010 >gi|8895506|gb|AF218039.1|AF218039 Cricke More ...
ATGTTAACAAGAATGAACATTTCTGATCTTACTTC DQ113899 Adult diarrheal rotavirus RP0466 466 Computational James F. Lynn 05/30/2010 >gi|69145430|gb|DQ113899.1| Adult diarrhe More ...
TGTTAAGAACCTGTTTAACACTTTCACAATGTCAG EU420138 Bat coronavirus RP0467 467 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
Summary for Structure (((((:::::[[[::)))))::::::::::::]]] - 7 records total
Structure:  (((((:::::[[[[))))):::::::::::::::::::::::::::::::::::::::::::::]]]]
Sequence Organism ID# ID Notes
CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGC HIV K03455 RP0578 578 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGC HIV K03455 RP0633 633 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:::::[[[[))))):::::::::::::::::::::::::::::::::::::::::::::]]]] - 2 records total
Structure:  (((((:::::[[[[[::)))))::::::::::::::::::::::::::::::::::::]]]]]
Sequence Organism ID# ID Notes
CCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCT HIV K03455 RP0601 601 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:::::[[[[[::)))))::::::::::::::::::::::::::::::::::::]]]]] - 1 records total
Structure:  (((((:::::[[[[[::)))))::::]]]]]
Sequence Organism ID# ID Notes
ATATAGGTGATCCAGAATATATAGAACTGGA NC_016157 Human papillomavirus RP0670 670 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure (((((:::::[[[[[::)))))::::]]]]] - 1 records total
Structure:  (((((::::[[[[[))))):::]]]]]
Sequence Organism ID# ID Notes
GTAGCAATACAGCAGCTACCAATGCTG HIV K03455 RP0628 628 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::[[[[[))))):::]]]]] - 1 records total
Structure:  (((((::::[[[[[:)))))::::::::::]]]]]
Sequence Organism ID# ID Notes
GCTCTATTAGATACAGGAGCAGATGATACAGTATT HIV K03455 RP0592 592 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::[[[[[:)))))::::::::::]]]]] - 1 records total
Structure:  (((((::::[[[[[[[[[)))))::::::::::::::::::::::::::::::::]]]]]]]]]
Sequence Organism ID# ID Notes
ACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGT HIV K03455 RP0583 583 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::[[[[[[[[[)))))::::::::::::::::::::::::::::::::]]]]]]]]] - 1 records total
Structure:  (((((:::[[[[:))))):::::]]]]
Sequence Organism ID# ID Notes
ATGCGATAACACGTGCATGGAAAGTGT H1N1 HA HM624086 RP0647 647 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
Summary for Structure (((((:::[[[[:))))):::::]]]] - 1 records total
Structure:  (((((:::[[[[:)))))::::]]]]
Sequence Organism ID# ID Notes
TGCGATAACACGTGCATGGAAAGTGT H1N1 HA HM624086 RP0649 649 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
Summary for Structure (((((:::[[[[:)))))::::]]]] - 1 records total
Structure:  (((((:::[[[[[[[))))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::]]]]]]]
Sequence Organism ID# ID Notes
AGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTG More ... HIV K03455 RP0604 604 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:::[[[[[[[))))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::]]]]]]] - 1 records total
Structure:  (((((::[[[)))))::::]]]
Sequence Organism ID# ID Notes
AGGCCATCGCGGCCTACCGGCG CP001807 Rhodothermus marinus RP0552 552 >gb|CP001807.1| Rhodothermus marinus DSM 4252, complete genome Length=3261604 M More ...
Summary for Structure (((((::[[[)))))::::]]] - 1 records total
Structure:  (((((::[[[:)))))::::::::]]]
Sequence Organism ID# ID Notes
GGCGGCGGCGACCGCCGAAACAACCGC X76931 cucurbit aphid-borne yellows virus RP0169 169 PKB-number: PKB44
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymeras More ...
GAAAACTTTTTTTTTCCGCTAGTAAAA DQ192570 Crow polyomavirus RP0270 270 >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational J More ...
TGCATACGATAATGCATAGTGGCTATC X82130 Odontoglossum ringspot virus RP0267 267 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
TGTACACGATAGTACATAGTGTTTATC X82130 Odontoglossum ringspot virus RP0268 268 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
ATCTGGAATATCAGATAGGATACATAT CY043336.1| Influenza A virus RP0278 278 >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme More ...
TAATTAGAACTAATTATGTGAATGGTT DQ113897.1| Adult diarrheal rotavirus RP0287 287 >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
ATGGGGACAGCCCCATGGTGGTGGCTG M33958 RP0303 303 >M33958 computational-sequence comparison James F. lynn 08-19-2009
CGGGGGGGGGGCCCCGGGGGGTCCCCC NC_001944 Beak and feather disease virus RP0371 371 method: computational James F. Lynn 10-25-09 >gi|9630729|ref|NC_001944.1| Beak a More ...
AGTCCATAATTGGACTCATTCAAAATT AF418014 Australian bat lyssavirus RP0442 442 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
TCTCTCAGATCAGAGATCTTTTCAATC AF418014 Australian bat lyssavirus RP0443 443 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
Summary for Structure (((((::[[[:)))))::::::::]]] - 10 records total
Structure:  (((((::[[[:[[))))):::::::]]]]]
Sequence Organism ID# ID Notes
CGAGAAGGAGATCTCTCGTAAATAAGACTC U68079 Legionella pneumophila RP0205 205 PKB-number: PKB67
Definition: Pseudoknot PK1 of Legionella pneumophila tmRNA
More ...
Summary for Structure (((((::[[[:[[))))):::::::]]]]] - 1 records total
Structure:  (((((::[[[[)))))::::::::::::::::]]]]
Sequence Organism ID# ID Notes
TTCCACAGGGATGGAAAGGATCACCAGCAATATTCC HIV K03455 RP0597 597 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::[[[[)))))::::::::::::::::]]]] - 1 records total
Structure:  (((((::[[[[))))):::::::]]]]
Sequence Organism ID# ID Notes
GGCGGCGGCGTCCGCCGTAACAAACGC L25299 barley yellow dwarf virus RP0171 171 PKB-number: PKB46 Definition: ORF2/ORF3 (putative RNA-dependent RNA polymerase More ...
Summary for Structure (((((::[[[[))))):::::::]]]] - 1 records total
Structure:  (((((::[[[[)))))::::::]]]]
Sequence Organism ID# ID Notes
CGCGGCACCGTCCGCGGAACAAACGG X13063 Beet Western-Yellows Virus RP0081 81 PKB-number: PKB2 Modification: 1999-6-21 Definition: Orf2-orf3 ribosomal f More ...
Summary for Structure (((((::[[[[)))))::::::]]]] - 1 records total
Structure:  (((((::[[[[[))))):::::::]]]]]
Sequence Organism ID# ID Notes
CTGGAGGAACAATCCAGCGGATATTTGTT NC_007193 Chaetoceros salsugineum RP0361 361 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
Summary for Structure (((((::[[[[[))))):::::::]]]]] - 1 records total
Structure:  (((((::[[[[[[))))):::::::::::]]]]]]
Sequence Organism ID# ID Notes
GGGGCGAGCTGCAGCCCCAGTGAATCAAATGCAGC M25381 Feline Immunodeficiency Virus RP0083 83 PKB-number: PKB4 Definition: Gag-pol ribosomal frameshift site of Feline Imm More ...
Summary for Structure (((((::[[[[[[))))):::::::::::]]]]]] - 1 records total
Structure:  (((((:[[))))):::::::::::::]]
Sequence Organism ID# ID Notes
CTTCTGGGAAGTTCAATTAGGAATACCA HIV K03455 RP0595 595 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[))))):::::::::::::]] - 1 records total
Structure:  (((((:[[[))))):::::::::]]]
Sequence Organism ID# ID Notes
CCTCGACCTTGAGGGAATGCTAAAGG NC_009597 Pyrococcus abyssi virus RP0332 332 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
Summary for Structure (((((:[[[))))):::::::::]]] - 1 records total
Structure:  (((((:[[[)))))::::::]]]
Sequence Organism ID# ID Notes
CCTTTATCTGAGGGTCTACCAGA NC016157 Human papillomavirus RP0660 660 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure (((((:[[[)))))::::::]]] - 1 records total
Structure:  (((((:[[[))))):::::]]]
Sequence Organism ID# ID Notes
CCCTCTTCCGAGGGTCATCGGA X16378 turnip yellow mosaic virus RP0512 512 Computational James F. Lynn 06/05/2010 KSPOS
CCCTTTTCCGAGGGTCATCGGA pdb 1A60 Chain A, Nmr Structure Of A Classical Pse RP0558 558 >pdb|1A60|A Chain A, Nmr Structure Of A Classical Pseudoknot: Interplay Of Sin More ...
CCCTTTTCCGAGGGTCATCGGA AF035403 Turnip yellow mosaic Blue Lake isolat RP0559 559 >gb|AF035403.1| Turnip yellow mosaic Blue Lake isolate, complete genome Length= More ...
CCCTTTTCCGAGGGTCATCGGA TYU88850 Turnip yellow mosaic virus variant Q18 RP0560 560 >gb|U88850.1|TYU88850 Turnip yellow mosaic virus variant Q18, virion protein (V More ...
CCCTTTTCCGAGGGTCATCGGA M58313 Andean potato latent virus RP0561 561 >gb|M58313.1|EMVRRLSZ Andean potato latent virus (APLV) 3' terminus tRNA-like s More ...
Summary for Structure (((((:[[[))))):::::]]] - 5 records total
Structure:  (((((:[[[)))))::::]]]
Sequence Organism ID# ID Notes
GTTGAAGGCTCAACATGGGCT NC_016157 Human papillomavirus RP0668 668 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure (((((:[[[)))))::::]]] - 1 records total
Structure:  (((((:[[[))))):::]]]
Sequence Organism ID# ID Notes
GTGCTATGGGGCATTCACCA H1N1 HA HM624086 RP0645 645 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
Summary for Structure (((((:[[[))))):::]]] - 1 records total
Structure:  (((((:[[[[))))):::]]]]
Sequence Organism ID# ID Notes
GGTTGTGCTCCAGCCTTAGGGC NC_016157 Human papillomavirus RP0671 671 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure (((((:[[[[))))):::]]]] - 1 records total
Structure:  (((((:[[[[:))))):::::::::::::::::::::::::::::::::::::::]]]]
Sequence Organism ID# ID Notes
CTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAG HIV K03455 RP0609 609 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[[[:))))):::::::::::::::::::::::::::::::::::::::]]]] - 1 records total
Structure:  (((((:[[[[:)))))::]]]]
Sequence Organism ID# ID Notes
TGCAGGGCCTATTGCACCAGGC HIV K03455 RP0585 585 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[[[:)))))::]]]] - 1 records total
Structure:  (((((:[[[[::::)))))::]]]]
Sequence Organism ID# ID Notes
TAAGCCTCAATAAAGCTTGCCTTGA HIV K03455 RP0580 580 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
TAAGCCTCAATAAAGCTTGCCTTGA HIV K03455 RP0635 635 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[[[::::)))))::]]]] - 2 records total
Structure:  (((((:[[[[[::))))):::]]]]]
Sequence Organism ID# ID Notes
TATGATCAGATACTCATAGAAATCTG HIV K03455 RP0593 593 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[[[[::))))):::]]]]] - 1 records total
Structure:  (((((:[[[[[[)))))::::::]]]]]]
Sequence Organism ID# ID Notes
AGCTTAAGAATGAAGCTGTTAGACATTTT HIV K03455 RP0611 611 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[[[[[)))))::::::]]]]]] - 1 records total
Structure:  (((((:[[[[[[::))))):::::]]]]]]
Sequence Organism ID# ID Notes
CGAGGGGCGGTTGGCCTCGTAAAAAGCCGC U68074 E.coli RP0174 174 PKB-number: PKB49 Definition: Pseudoknot PK1 of E.coli tmRNA Organism: E.coli More ...
GCGCCCCTTTGGGGGGCGCAAAGTCCAAAG GU979419 Spissistilus festinus virus RP0530 530 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure (((((:[[[[[[::))))):::::]]]]]] - 2 records total
Structure:  (((((:[[[[[[[)))))::::::::::::::::::::::]]]]]]]
Sequence Organism ID# ID Notes
TCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGC DQ399707 Xenotropic MuLV RP0659 659 >gi|88765817|gb|DQ399707.1| Xenotropic MuLV-related virus VP62, complete genome More ...
Summary for Structure (((((:[[[[[[[)))))::::::::::::::::::::::]]]]]]] - 1 records total
Structure:  (((((:[[[[[[[))))):::::::]]]]]]]
Sequence Organism ID# ID Notes
TGACCAGCTATGAGGTCATACATCGTCATAGC X12460 T2 bacteriophage RP0206 206 PKB-number: PKB73
Definition: Pseudoknot of the regulatory region of bacterio More ...
Summary for Structure (((((:[[[[[[[))))):::::::]]]]]]] - 1 records total
Structure:  (((((:[[[[[[[:)))))::::::::]]]]]]]
Sequence Organism ID# ID Notes
GGGGCAGTCCCCTAGCCCCGCTCAAAAGGGGGAT AF033807 mouse mammary tumor viru RP0210 210 PKB-number: PKB80
Definition: Gag/pro ribosomal frameshift site of mouse mamm More ...
Summary for Structure (((((:[[[[[[[:)))))::::::::]]]]]]] - 1 records total
Structure:  ((((...[[[[))))....]]]]
Sequence Organism ID# ID Notes
CGCTGAAACGGAGCGATATCCGT X78602 peanut clump virus RP0563 563 PKB-number PKB33 Definition:tRNA-like structure 3'end pseudoknot of RNA1 X78602 More ...
Summary for Structure ((((...[[[[))))....]]]] - 1 records total
Structure:  ((((:::(((((:[[[[[))))):::)))):::::::::::]]]]]
Sequence Organism ID# ID Notes
GCGTGGAAGCCCTGCCTGGGGTTGAAGCGTTAAAACTTAATCAGGC U68074 E.coli RP0176 176 PKB-number: PKB51 Definition: Pseudoknot PK3 of E.coli tmRNA Organism: E.coli More ...
Summary for Structure ((((:::(((((:[[[[[))))):::)))):::::::::::]]]]] - 1 records total
Structure:  ((((::::::::::::::[[:[[:)))):::::]]:]]
Sequence Organism ID# ID Notes
CATGGTGGTGGCTGGGGGCAACCCCATGGTGGCGGCTG AY765383 Brachyteles arachnoides prion RP0650 650 >gb|AY765383.1| Brachyteles arachnoides prion protein (PrP) gene, partial cdsSe More ...
CATGGTGGTGGCTGGGGGCAACCCCATGGTGGCGGCTG U15164 APU15164 Ateles paniscus RP0653 653 >gb|U15164.1|APU15164 Ateles paniscus x Ateles fusciceps major prion protein pr More ...
Summary for Structure ((((::::::::::::::[[:[[:)))):::::]]:]] - 2 records total
Structure:  ((((::::::::::::::[[[[[:)))):::::]]]]]
Sequence Organism ID# ID Notes
CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG U08309 geoffroyi prion RP0307 307 >gi|474376|gb|U08309.1|AGU08309 Ateles geoffroyi prion protein gene, partial cd More ...
CATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTG NM_000311.3| Homo sapiens prion RP0313 313 computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho More ...
CATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTG NM_000311.3| Homo sapiens prion protein RP0314 314 computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho More ...
CATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTG NM_000311 Homo sapiens prion protein RP0315 315 computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho More ...
CATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTG NM_000311.3| Homo sapiens prion protein RP0316 316 computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho More ...
CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG AY765383 Brachyteles arachnoides prion RP0651 651 >gb|AY765383.1| Brachyteles arachnoides prion protein (PrP) gene, partial cdsSe More ...
CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG U15164 APU15164 Ateles paniscus RP0652 652 >gb|U15164.1|APU15164 Ateles paniscus x Ateles fusciceps major prion protein pr More ...
CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG U08309 AGU08309 Ateles geoffroyi prion RP0654 654 >gb|U08309.1|AGU08309 Ateles geoffroyi prion protein gene, partial cdsSeq compa More ...
CATGGTGGCGGCTGGGGACAGCCTCATGGTGGTGGCTG U08309 AGU08309 Ateles geoffroyi prion RP0655 655 >gb|U08309.1|AGU08309 Ateles geoffroyi prion protein gene, partial cdsSeq compa More ...
CATGGTGGCGGCTGGGGACAGCCCCATGGTGGCGGCTG XM_002747325 Callithrix jacchus RP0656 656 >ref|XM_002747325.1| PREDICTED: Callithrix jacchus major prion protein-like, tr More ...
Summary for Structure ((((::::::::::::::[[[[[:)))):::::]]]]] - 10 records total
Structure:  ((((:::::::::::[[[[[:)))):::::]]]]]
Sequence Organism ID# ID Notes
GAGGACACCACCACCGGGGAACCTTCCACCTCCCT NC_016157 Human papillomavirus RP0665 665 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((:::::::::::[[[[[:)))):::::]]]]] - 1 records total
Structure:  ((((::::::::::[[[[[[:::))))::::::::]]]]]]
Sequence Organism ID# ID Notes
CAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTT HIV K03455 RP0599 599 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((::::::::::[[[[[[:::))))::::::::]]]]]] - 1 records total
Structure:  ((((::::::::[[[[[[::)))):::::::]]]]]]
Sequence Organism ID# ID Notes
CTACAAATATTTCTGTGCAGGTAGAGACAGAGCATAG NC_016157 Human papillomavirus RP0661 661 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((::::::::[[[[[[::)))):::::::]]]]]] - 1 records total
Structure:  ((((::::::[[[[[[[[))))::]]]]]]]]
Sequence Organism ID# ID Notes
AGCCTTTGTACCGGGAGTGGTTGCATTTTTGG NC_016157 Human papillomavirus RP0674 674 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((::::::[[[[[[[[))))::]]]]]]]] - 1 records total
Structure:  ((((:::::[[[))))::::]]]
Sequence Organism ID# ID Notes
TTTGTTTCATAACAAAAGCCTTA >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im RP0117 117 M0017
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
GCCCGTTCAAGGGGGCTCAGCCT NC_009597 Pyrococcus abyssi virus RP0297 297 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
ACCTGGAGGAGGAGGTTTTGCCT NC_007014 Small anellovirus 2 RP0369 369 method: computational James F. Lynn 10-25-09 >gi|66391753|ref|NC_007014.1| Small More ...
CCCCCCCCTGGGGGGGATTCCCC NC_001427 Chicken anemia virus RP0382 382 method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke More ...
ATTGATGGCCAGCAATTCCTCTG 52352969 ebolavirus RP0390 390 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
GAAATTTTTCTTTTTCATTGAAG 52352969 ebolavirus RP0401 401 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
TTGGGTCTCCATCCAAAATCATG AF418014 Australian bat lyssavirus RP0444 444 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
CACACCCACCCGTGTGTGTTCGG GU979419 Spissistilus festinus virus RP0529 529 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((:::::[[[))))::::]]] - 8 records total
Structure:  ((((:::::[[[[))))::::::::::::]]]]
Sequence Organism ID# ID Notes
AGACCTCCAGTGGGTCTCTAGGGGCACACCCAC Bovine Leukemia Virus AF033818 RP0112 112 M0012 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((:::::[[[[)))): More ...
AATTTACTTTTTCAATTGATGAAAATTGTGAAA DQ249299 Duck hepatitis virus RP0272 272 >gi|82468324|gb|DQ249299.1| Duck hepatitis virus 1 strain 03D, complete sequenc More ...
CAGGTACCATAAACCTGTTTTTCCTGGGTTTTA DQ249299 Duck hepatitis virus RP0273 273 >gi|82468324|gb|DQ249299.1| Duck hepatitis virus 1 strain 03D, complete sequenc More ...
TTTCTCGTCGGAAGAAAATATGCTGAGCTTTCC NC_009597 Pyrococcus abyssi virus RP0296 296 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
CTCTTTTTAAATTAGAGACAATTTGAACTAATT AF085363 RP0328 328 computational-sequence comparison James F. lynn 08-19-2009 AF085363 ~7286-7411
CTCTTTTTAAATTAGAGACAATTTGAACTAATT M16560 RP0327 327 computational-sequence comparison James F. lynn 08-19-2009 >M16560/7270-7389
CTCCTTCTAAATTGGAGACAATTTGAAATAATT AY302556 Human echovirus 33 RP0330 330 computational-sequence comparison James F. lynn 08-19-2009 >AY302556 ~7274-7394
CTCTTTTTAAATTAGAGACAATTTGAAATAATT AF241359 RP0321 321 computational-sequence comparison James F. lynn 08-19-2009 >AF241359 ~7291-7411
AACCTGAATCCCAGGTTGATGAAGCGGGATGGG GU979419 Spissistilus festinus virus RP0531 531 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((:::::[[[[))))::::::::::::]]]] - 9 records total
Structure:  ((((:::::[[[[)))):::]]]]
Sequence Organism ID# ID Notes
GGTGGAGATGGGGCACCATGCTCC HIV K03455 RP0616 616 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((:::::[[[[)))):::]]]] - 1 records total
Structure:  ((((:::::[[[[[))))::::::]:]]]]
Sequence Organism ID# ID Notes
AGTGTTTTTCCCTCCACTTAAATCGAAGGG J02415 tobacco mosaic virus RP0180 180 PKB-number: PKB55 Definition: Pseudoknot PK3 of the upstream pseudoknot domain More ...
AGTGTTTGTCCCTCCACTTAAATCGAAGGG U34586 odontoglossum ringspot virus RP0183 183 PKB-number: PKB58 Definition: Pseudoknot PK3 of the upstream pseudoknot domain More ...
AGTGTTTATCCCTCCACTTGAATCGAAGGG U34586 odontoglossum ringspot virus RP0185 185 PKB-number: PKB60 Definition: Pseudoknot PK3 of the upstream pseudoknot domain More ...
AGTGGTTATCCCTCCACTTAAATCGAAGGG U34586 odontoglossum ringspot virus RP0203 203 PKB-number: PKB62 Definition: Pseudoknot PK3 of the upstream pseudoknot domain More ...
AGTGTTTTTCCCTCCACTTAAATCGAAGGG X02144 tobacco mosaic virus RP0214 214 PKB-number: PKB84
Definition: Pseudoknot PK3 of the upstream pseudoknot domai More ...
Summary for Structure ((((:::::[[[[[))))::::::]:]]]] - 5 records total
Structure:  ((((::::[[[[))))::]]]]
Sequence Organism ID# ID Notes
CCAGATCTGAGCCTGGGAGCTC HIV K03455 RP0579 579 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
CCAGATCTGAGCCTGGGAGCTC HIV K03455 RP0634 634 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((::::[[[[))))::]]]] - 2 records total
Structure:  ((((::::[[[[[[))))::::::::]]]]]]
Sequence Organism ID# ID Notes
CCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGC HIV K03455 RP0606 606 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((::::[[[[[[))))::::::::]]]]]] - 1 records total
Structure:  ((((:::[[[))))::::]]]
Sequence Organism ID# ID Notes
GAGCAATTGAGCTCAGTGTCA H1N1 HA HM624086 RP0644 644 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
Summary for Structure ((((:::[[[))))::::]]] - 1 records total
Structure:  ((((:::[[[:::)))):::::::::]]]
Sequence Organism ID# ID Notes
GATTGTTTTTCAGAATCTGCTATAAGAAA A07108 HIV RP0014 14 >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
AGCATCCCCCAGCTGCTTCAGGTGCAGGG DQ192570 Crow polyomavirus RP0271 271 >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational J More ...
CCTCCTCGTTATCGAGGAGGCTTCAGAAC NC_007193 Chaetoceros salsugineum RP0360 360 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
AAGGTACTGGGACCCTTACTGTCCCTCCA 52352969 ebolavirus RP0393 393 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
CAAAAGTATACTGTTTGAACCCCTAGTAT 52352969 ebolavirus RP0399 399 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
TTCAGACATTGCGTGAACTCCTCCTTAAT 52352969 ebolavirus RP0400 400 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
TGAAACAAGATCCTTCACAACCCACTTCT 52352969 ebolavirus RP0405 405 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
TATCGATTATGTTGATAATGTAAATAATA 52352969 ebolavirus RP0407 407 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
CCCGAGCCATATACGGGGTCGAGCCCATG GU979419 Spissistilus festinus virus RP0532 532 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GCCTAGAAAAGTGAGGCAAGGGATGTTTT GU979419 Spissistilus festinus virus RP0533 533 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((:::[[[:::)))):::::::::]]] - 10 records total
Structure:  ((((:::[[[[)))):::::::::]]]]
Sequence Organism ID# ID Notes
TAAAAAGAAATTTTAACTCTCCAGATTT X82130 Odontoglossum ringspot virus RP0197 197 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
TTGCACTCCCTGCAAGGGACACAGAGGG NC_012958 Drosophila A virus RP0342 342 method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr More ...
TAGTATTTTATACTAACTCTAGGAATAA NC_003871 Carrot red leaf luteovirus RP0350 350 method: computational James F. Lynn 10-24-2009 >gi|20889313|ref|NC_003871.1| Car More ...
Summary for Structure ((((:::[[[[)))):::::::::]]]] - 3 records total
Structure:  ((((:::[[[[)))):::::]]]]
Sequence Organism ID# ID Notes
TTTTAAATTTTAAAAGCATCAAAA AP000545 Homo sapiens RP0221 221 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AAGCGTTCTTTGCTTATGAAAAAG DQ113897.1| Adult diarrheal rotavirus RP0285 285 >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
TCGGAACTGGCCCGAACAATGCCA NC_009597 Pyrococcus abyssi virus RP0298 298 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
TTTTCAACAACAAAATCCTGGTTG NC_012126 California sea lion anellovirus RP0364 364 method: computational James F. Lynn 10-25-09 >gi|224504298|ref|NC_012126.1| Cali More ...
Summary for Structure ((((:::[[[[)))):::::]]]] - 4 records total
Sequence Organism ID# ID Notes
Page summary 177 - records total
Global summary 674 - records total