Sequence to Structure Report

Structure:  NULL
Organism Sequence ID# ID Notes
RP0648 648
Summary for Structure NULL - 1 records total
Structure:  (((((((((((::(((:::[[[[[)))::))))::::)))))))::::::::::]]]]]
Organism Sequence ID# ID Notes
U68074 E.coli CCTCTCTCCCTAGCCTCCGCTCTTAGGACGGGGATCAAGAGAGGTCAAACCCAAAAGAG RP0175 175 PKB-number: PKB50 Definition: Pseudoknot PK2 of E.coli tmRNA Organism: E.coli More ...
Summary for Structure (((((((((((::(((:::[[[[[)))::))))::::)))))))::::::::::]]]]] - 1 records total
Structure:  ((((((((((:(((:[[[:[[[))):)))))))))):::::::::]]]:]]]
Organism Sequence ID# ID Notes
U68074 E.coli GTTTGTTAGTGGCGTGTCCGTCCGCAGCTGGCAAGCGAATGTAAAGACTGAC RP0177 177 PKB-number: PKB52 Definition: Pseudoknot PK4 of E.coli tmRNA Organism: E.coli More ...
Summary for Structure ((((((((((:(((:[[[:[[[))):)))))))))):::::::::]]]:]]] - 1 records total
Structure:  ((((((((((::::::::[[[[[[[[[::::))))))))))::::]]]]]]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus AAAATGTAAATATTATTTCATTTTTAACTGCTTTGCGTTTTATGTTTAAAGGTG RP0664 664 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((((((::::::::[[[[[[[[[::::))))))))))::::]]]]]]]]] - 1 records total
Structure:  ((((((((((:[[[[)))))))))):::::]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus GGGGTAATAACTTGTTTGTTACCTTTTTGGATAA RP0672 672 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((((((:[[[[)))))))))):::::]]]] - 1 records total
Structure:  (((((((((::[[[[)))))))))::]]]]
Organism Sequence ID# ID Notes
HIV K03455 GTTATCTATCAATACATGGATGATTTGTAT RP0598 598 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((((::[[[[)))))))))::]]]] - 1 records total
Structure:  (((((((((:[[[[[::::::)))))))))::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTC RP0590 590 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((((:[[[[[::::::)))))))))::::]]]]] - 1 records total
Structure:  (((((((((:[[[[[[))))))))):::::::::::::::::::]]]]]]
Organism Sequence ID# ID Notes
C. botulinum NC_010520 AATAAGAGGCTTTGTATCTCTTATTGAATCTTTAGTAATAGGCATACAAA RP0657 657 viral read though like KSPOS J.Lynn 04/19/2011
Summary for Structure (((((((((:[[[[[[))))))))):::::::::::::::::::]]]]]] - 1 records total
Structure:  ((((((((:::[[)))))))):::::]]
Organism Sequence ID# ID Notes
HIV K03455 TGGTGCTACAAGCTAGTACCAGTTGAGC RP0576 576 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
HIV K03455 TGGTGCTACAAGCTAGTACCAGTTGAGC RP0631 631 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((((:::[[)))))))):::::]] - 2 records total
Structure:  ((((((((::[[[[[:::::::::::::))))))))::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGAC RP0618 618 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...

Sequence to Structure Report

Summary for Structure ((((((((::[[[[[:::::::::::::))))))))::]]]]] - 1 records total
Structure:  ((((((((::[[[[[[[)))))))):::::::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
M26927 gibbon ape leukemia virus GGGTTCGGACCCCCTCCCCGAACCTAGGGTAACACTGACTGUGGAGGGG RP0209 209 PKB-number: PKB79
Definition: Gag/pol translational readthrough site of gibbo More ...
Summary for Structure ((((((((::[[[[[[[)))))))):::::::::::::::::]]]]]]] - 1 records total
Structure:  ((((((((::[[[[[[[)))))))):::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
C. botulinum NC_010520 AATTACTTTTATTATTTAAGTAATTTGGCTTTTTATATAAATAAT RP0658 658 viral read though like KSPOS J.Lynn 04/19/2011
Summary for Structure ((((((((::[[[[[[[)))))))):::::::::::::]]]]]]] - 1 records total
Structure:  ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
AF033811 Moloney murine leukemia virus GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGC RP0172 172 PKB-number: PKB47 Definition: Gag/pol translational readthrough site of Molone More ...
J01998 AKV murine leukemia virus GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCACTGTCGGGGGGC RP0208 208 PKB-number: PKB78
Definition: Gag/pol translational readthrough site of AKV m More ...
Summary for Structure ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]] - 2 records total
Structure:  (((((((:::::::::::[[[[))))))):::]]]]
Organism Sequence ID# ID Notes
HIV K03455 GTCAACATAATTGGAAGAAATCTGTTGACTCAGATT RP0594 594 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((:::::::::::[[[[))))))):::]]]] - 1 records total
Structure:  (((((((::::::[[[[[[[[))))))):::::::::::::::::]]]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGG RP0612 612 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::::::[[[[[[[[))))))):::::::::::::::::]]]]]]]] - 1 records total
Structure:  (((((((:::::[[[:)))))))::]]]
Organism Sequence ID# ID Notes
HIV K03455 CTTGCTGAAGCGCGCACGGCAAGAGGCG RP0581 581 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((:::::[[[:)))))))::]]] - 1 records total
Structure:  (((((((::::[[[[((((:::::((((((((:::::))))))))))))))))))):::::::]]]]
Organism Sequence ID# ID Notes
J02415 tobacco mosaic virus TGTGTCTTGGATCGCGCGGGTCAAATGTATATGGTTCATATACATCCGCAGGCACGTAATAAAGCGA RP0182 182 PKB-number: PKB57 Definition: tRNA-like structure bulge pseudoknot of tobacco More ...
Summary for Structure (((((((::::[[[[((((:::::((((((((:::::))))))))))))))))))):::::::]]]] - 1 records total
Structure:  (((((((::::[[[[[)))))))::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TGTTCCTTGGGTTCTTGGGAGCAGCAGGAA RP0621 621 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::::[[[[[)))))))::]]]]] - 1 records total
Structure:  (((((((::::[[[[[[::)))))))::::::::]]]]]]
Organism Sequence ID# ID Notes
AF033818 Bovine leukemia virus AGTGGGTCTCTAGGGGCACACCCACTACCCGCCGGCCCCT RP0421 421 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
Summary for Structure (((((((::::[[[[[[::)))))))::::::::]]]]]] - 1 records total
Page summary 10 - records total

Sequence to Structure Report

Structure:  (((((((::::[[[[[[::::))))))):::::::::::::::::::::::::::::::::::::::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGG RP0610 610 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::::[[[[[[::::))))))):::::::::::::::::::::::::::::::::::::::]]]]]] - 1 records total
Structure:  (((((((::[[[))))))):::]]]
Organism Sequence ID# ID Notes
HIV K03455 TTGAGAGACTTACTCTTGATTGTAA RP0624 624 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::[[[))))))):::]]] - 1 records total
Structure:  (((((((::[[[::::))))))):::::::::::]]]
Organism Sequence ID# ID Notes
HIV K03455 TTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCT RP0589 589 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::[[[::::))))))):::::::::::]]] - 1 records total
Structure:  (((((((:[[)))))))::]]
Organism Sequence ID# ID Notes
NC_010317 Abaca bunchy top virus GGCTTCCTGCGGAAGCCAGGC RP0459 459 >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com More ...
Summary for Structure (((((((:[[)))))))::]] - 1 records total
Structure:  ((((((:(::[[[[[[[):))))))::::::::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
M54993 spleen necrosis virus GGGTTCTCCCGCCCTCCGTGAACCCAGGCTAAAAGTTAAGGTAGGGGGGC RP0173 173 PKB-number: PKB48 Definition: Gag/pol translational readthrough site of spleen More ...
Summary for Structure ((((((:(::[[[[[[[):))))))::::::::::::::::::]]]]]]] - 1 records total
Structure:  ((((((:::::::::::::::::[[[[[::::::::))))))::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCC RP0629 629 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:::::::::::::::::[[[[[::::::::))))))::::]]]]] - 1 records total
Structure:  ((((((:::::::[[[[:::::)))))):::]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus TGTACAAGATATATACCGTTCATGTGCACAAGGTG RP0667 667 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((:::::::[[[[:::::)))))):::]]]] - 1 records total
Structure:  ((((((::::::[[))))))::::]]
Organism Sequence ID# ID Notes
AF033818 Bovine leukemia virus GGGGGGACTTAGCGCCCCCCAAACCG RP0416 416 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
X13063 Turnip yellows virus ACTCAGTATTGTGCCTGAGTGATGGC RP0423 423 >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA Computationa More ...
Summary for Structure ((((((::::::[[))))))::::]] - 2 records total
Structure:  ((((((:::::[[[))))))::::]]]
Organism Sequence ID# ID Notes
AF033818 Bovine Leukemia Virus GGGGGGACTTAGCGCCCCCCAAACCGT RP0080 80 PKB-number: PKB1 Definition: Gag/pro ribosomal frameshift site of Bovine Leuke More ...
X13063 Turnip yellows virus ACTCAGTATTGTGCCTGAGTGATGGCA RP0101 101 >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA12-25-08 Jame More ...
Chayote yellow mosaic virus NC_004618 CCACACAAATAATTGTGTGGTCCCAAT RP0441 441 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu More ...
Summary for Structure ((((((:::::[[[))))))::::]]] - 3 records total
Page summary 12 - records total

Sequence to Structure Report

Structure:  ((((((:::::[[[[[:))))))::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 CTGGGGATTTGGGGTTGCTCTGGAAAACTC RP0623 623 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:::::[[[[[:))))))::]]]]] - 1 records total
Structure:  ((((((::::[[[))))))::]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus GGCATCACACACAGATGCTGATGT RP0669 669 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((::::[[[))))))::]]] - 1 records total
Structure:  ((((((:::[[[[))))))::::::::::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 GAGACCTCCAGTGGGTCTCTAGGGGCACACCCACT RP0102 102 M0002 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((((:::[[[[)))))) More ...
AF033820 Equine Infectious Anemic Virus GGGGCTCAAGGGAGGCCCCAGAAACAAACTTTCCC RP0082 82 PKB-number: PKB3 Definition: Gag-pol ribosomal frameshift site of Equine Infec More ...
Summary for Structure ((((((:::[[[[))))))::::::::::::]]]] - 2 records total
Structure:  ((((((:::[[[[)))))):::::::::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 TTTCAGGTGGCGTCTGAAAAGACTCGCCAGACGC RP0103 103 M0003 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((((:::[[[[)))))) More ...
Summary for Structure ((((((:::[[[[)))))):::::::::::]]]] - 1 records total
Structure:  ((((((:::[[[[::))))))::::::::]]]]
Organism Sequence ID# ID Notes
AF033818 Bovine leukemia virus TCCGGGATTGATCACCCCGGAACCCTAACGATC RP0422 422 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
Summary for Structure ((((((:::[[[[::))))))::::::::]]]] - 1 records total
Structure:  ((((((:::[[[[[[[:))))))::]]]]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus GTAGTTTCAGCTTTTGCAGCTGCGACAGAAGT RP0662 662 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((:::[[[[[[[:))))))::]]]]]]] - 1 records total
Structure:  ((((((:::[[[[[[[::::::)))))):::]]]]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus AAACATGAGTATGGCAGAATGGGTGTTTAAATGCTGTA RP0663 663 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((:::[[[[[[[::::::)))))):::]]]]]]] - 1 records total
Structure:  ((((((:::[[[[[[[[:::::)))))):::::]]]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 ACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTG RP0619 619 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:::[[[[[[[[:::::)))))):::::]]]]]]]] - 1 records total
Structure:  ((((((::[[[[))))))::::::]]]]
Organism Sequence ID# ID Notes
L04573 pea enation mosaic virus TTCCGGTCGACTCCGGAGAAACAAAGTC RP0170 170 PKB-number: PKB45
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymeras More ...
Australian bat lyssavirus AF418014 GAGTCCATAATTGGACTCATTCAAAATT RP0434 434 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
Summary for Structure ((((((::[[[[))))))::::::]]]] - 2 records total
Structure:  ((((((::[[[[[::::)))))):::::::::::::::::::::::::::::::::::::::::::::::::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGA RP0596 596 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Page summary 12 - records total

Sequence to Structure Report

Summary for Structure ((((((::[[[[[::::)))))):::::::::::::::::::::::::::::::::::::::::::::::::::]]]]] - 1 records total
Structure:  ((((((:[[)))))):::]]
Organism Sequence ID# ID Notes
HIV K03455 TACAAGGAGCTTGTAGAGCT RP0626 626 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:[[)))))):::]] - 1 records total
Structure:  ((((((:[[[))))))::::::::::::::::::::::::::::]]]
Organism Sequence ID# ID Notes
HIV K03455 CCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGC RP0614 614 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:[[[))))))::::::::::::::::::::::::::::]]] - 1 records total
Structure:  ((((((:[[[[)))))):::]]]]
Organism Sequence ID# ID Notes
U34586 odontoglossum ringspot virus TAACGTTGATAGTGTTGAACTATC RP0181 181 PKB-number: PKB56 Definition: Pseudoknot PK1 of the upstream pseudoknot domain More ...
Summary for Structure ((((((:[[[[)))))):::]]]] - 1 records total
Structure:  ((((((:[[[[:[[[::::)))))):::::]]]:]]]]
Organism Sequence ID# ID Notes
NC_010319 Abaca bunchy top virus GAGGATTACTTGAATTACGGAATTCTGAGGAATTCAAG RP0457 457 >gi|167006434|ref|NC_010319.1| Abaca bunchy top virus DNA-R, complete genome Com More ...
Summary for Structure ((((((:[[[[:[[[::::)))))):::::]]]:]]]] - 1 records total
Structure:  ((((((:[[[[[[[::::::::::::))))))::::::]]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAG RP0588 588 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:[[[[[[[::::::::::::))))))::::::]]]]]]] - 1 records total
Structure:  (((((::::::::::::::::::[[[[[::::))))):::::::::::::::::::::::::::::::::::::::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 AAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAG More ... RP0586 586 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::::::::::::::::[[[[[::::))))):::::::::::::::::::::::::::::::::::::::::]]]]] - 1 records total
Structure:  (((((:::::::::::::::::[[[[[)))))::::::::::::::::::::::::::::::::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 ATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCC RP0603 603 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:::::::::::::::::[[[[[)))))::::::::::::::::::::::::::::::::::]]]]] - 1 records total
Structure:  (((((::::::::::[[[[[[))))):::::::::::::::::::::::::::::::::::::::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCT RP0615 615 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::::::::[[[[[[))))):::::::::::::::::::::::::::::::::::::::]]]]]] - 1 records total
Structure:  (((((::::::::[[[[:))))):::::::::::::]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTA RP0602 602 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::::::[[[[:))))):::::::::::::]]]] - 1 records total
Structure:  (((((:::::[[[)))))::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im AAAGAAATAGCTGTCTTTTATCCAG RP0116 116 M0016
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
Page summary 10 - records total

Sequence to Structure Report

NC_009597 Pyrococcus abyssi virus GGATTTCTTCAATAATCCCCCCATT RP0295 295 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
AJ577589 Human echovirus 11 AATTAACAAATTATAATTGGCTTAA RP0329 329 computational-sequence comparison James F. lynn 08-19-2009 >AJ577589 ~7312-7433
NC_007193 Chaetoceros salsugineum GATATTGGAGTGAATATCTTGATCA RP0362 362 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
NC_001427 Chicken anemia virus GGGGGCCGGAGGCCCCCCGGTGGCC RP0377 377 method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke More ...
Summary for Structure (((((:::::[[[)))))::::]]] - 5 records total
Structure:  (((((:::::[[[::)))))::::::::::::]]]
Organism Sequence ID# ID Notes
NC_010317 Abaca bunchy top virus TAGAGGATCAGCCGACTCTATAAATATAGGGAGGC RP0460 460 >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com More ...
NC_010315 Abaca bunchy top virus segment 2 GTATTTAAATATTTAAATACCAAACCTTAAGGAAT RP0462 462 >gi|167006427|ref|NC_010315.1| Abaca bunchy top virus segment 2, complete sequen More ...
NC_010315 Abaca bunchy top virus segment 2 TATATTAAATATAACATATAAAATATATAAGGTAT RP0463 463 >gi|167006427|ref|NC_010315.1| Abaca bunchy top virus segment 2, complete sequen More ...
AF009606 Hepatitis C virus GCGGCTACCGCAGGTGCCGCGCGAGCGGCGTACTG RP0464 464 Computational James F. Lynn 05/30/2010 >gi|2316097|gb|AF009606.1|AF009606 Hepati More ...
AF218039 Cricket paralysis virus TTGAGGAGCTTGCTGCTCAAGAACTAATAGCAGCA RP0465 465 Computational James F. Lynn 05/30/2010 >gi|8895506|gb|AF218039.1|AF218039 Cricke More ...
DQ113899 Adult diarrheal rotavirus ATGTTAACAAGAATGAACATTTCTGATCTTACTTC RP0466 466 Computational James F. Lynn 05/30/2010 >gi|69145430|gb|DQ113899.1| Adult diarrhe More ...
EU420138 Bat coronavirus TGTTAAGAACCTGTTTAACACTTTCACAATGTCAG RP0467 467 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
Summary for Structure (((((:::::[[[::)))))::::::::::::]]] - 7 records total
Structure:  (((((:::::[[[[))))):::::::::::::::::::::::::::::::::::::::::::::]]]]
Organism Sequence ID# ID Notes
HIV K03455 CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGC RP0578 578 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
HIV K03455 CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGC RP0633 633 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:::::[[[[))))):::::::::::::::::::::::::::::::::::::::::::::]]]] - 2 records total
Structure:  (((((:::::[[[[[::)))))::::::::::::::::::::::::::::::::::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 CCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCT RP0601 601 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:::::[[[[[::)))))::::::::::::::::::::::::::::::::::::]]]]] - 1 records total
Structure:  (((((:::::[[[[[::)))))::::]]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus ATATAGGTGATCCAGAATATATAGAACTGGA RP0670 670 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure (((((:::::[[[[[::)))))::::]]]]] - 1 records total
Structure:  (((((::::[[[[[))))):::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GTAGCAATACAGCAGCTACCAATGCTG RP0628 628 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::[[[[[))))):::]]]]] - 1 records total
Structure:  (((((::::[[[[[:)))))::::::::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GCTCTATTAGATACAGGAGCAGATGATACAGTATT RP0592 592 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::[[[[[:)))))::::::::::]]]]] - 1 records total
Page summary 17 - records total

Sequence to Structure Report

Structure:  (((((::::[[[[[[[[[)))))::::::::::::::::::::::::::::::::]]]]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 ACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGT RP0583 583 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::::[[[[[[[[[)))))::::::::::::::::::::::::::::::::]]]]]]]]] - 1 records total
Structure:  (((((:::[[[[:))))):::::]]]]
Organism Sequence ID# ID Notes
H1N1 HA HM624086 ATGCGATAACACGTGCATGGAAAGTGT RP0647 647 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
Summary for Structure (((((:::[[[[:))))):::::]]]] - 1 records total
Structure:  (((((:::[[[[:)))))::::]]]]
Organism Sequence ID# ID Notes
H1N1 HA HM624086 TGCGATAACACGTGCATGGAAAGTGT RP0649 649 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
Summary for Structure (((((:::[[[[:)))))::::]]]] - 1 records total
Structure:  (((((:::[[[[[[[))))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 AGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTG More ... RP0604 604 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:::[[[[[[[))))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::]]]]]]] - 1 records total
Structure:  (((((::[[[)))))::::]]]
Organism Sequence ID# ID Notes
CP001807 Rhodothermus marinus AGGCCATCGCGGCCTACCGGCG RP0552 552 >gb|CP001807.1| Rhodothermus marinus DSM 4252, complete genome Length=3261604 M More ...
Summary for Structure (((((::[[[)))))::::]]] - 1 records total
Structure:  (((((::[[[:)))))::::::::]]]
Organism Sequence ID# ID Notes
X76931 cucurbit aphid-borne yellows virus GGCGGCGGCGACCGCCGAAACAACCGC RP0169 169 PKB-number: PKB44
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymeras More ...
DQ192570 Crow polyomavirus GAAAACTTTTTTTTTCCGCTAGTAAAA RP0270 270 >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational J More ...
X82130 Odontoglossum ringspot virus TGCATACGATAATGCATAGTGGCTATC RP0267 267 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
X82130 Odontoglossum ringspot virus TGTACACGATAGTACATAGTGTTTATC RP0268 268 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
CY043336.1| Influenza A virus ATCTGGAATATCAGATAGGATACATAT RP0278 278 >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme More ...
DQ113897.1| Adult diarrheal rotavirus TAATTAGAACTAATTATGTGAATGGTT RP0287 287 >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
M33958 ATGGGGACAGCCCCATGGTGGTGGCTG RP0303 303 >M33958 computational-sequence comparison James F. lynn 08-19-2009
NC_001944 Beak and feather disease virus CGGGGGGGGGGCCCCGGGGGGTCCCCC RP0371 371 method: computational James F. Lynn 10-25-09 >gi|9630729|ref|NC_001944.1| Beak a More ...
AF418014 Australian bat lyssavirus AGTCCATAATTGGACTCATTCAAAATT RP0442 442 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
AF418014 Australian bat lyssavirus TCTCTCAGATCAGAGATCTTTTCAATC RP0443 443 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
Summary for Structure (((((::[[[:)))))::::::::]]] - 10 records total
Structure:  (((((::[[[:[[))))):::::::]]]]]
Organism Sequence ID# ID Notes
U68079 Legionella pneumophila CGAGAAGGAGATCTCTCGTAAATAAGACTC RP0205 205 PKB-number: PKB67
Definition: Pseudoknot PK1 of Legionella pneumophila tmRNA
More ...
Summary for Structure (((((::[[[:[[))))):::::::]]]]] - 1 records total
Page summary 16 - records total

Sequence to Structure Report

Structure:  (((((::[[[[)))))::::::::::::::::]]]]
Organism Sequence ID# ID Notes
HIV K03455 TTCCACAGGGATGGAAAGGATCACCAGCAATATTCC RP0597 597 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((::[[[[)))))::::::::::::::::]]]] - 1 records total
Structure:  (((((::[[[[))))):::::::]]]]
Organism Sequence ID# ID Notes
L25299 barley yellow dwarf virus GGCGGCGGCGTCCGCCGTAACAAACGC RP0171 171 PKB-number: PKB46 Definition: ORF2/ORF3 (putative RNA-dependent RNA polymerase More ...
Summary for Structure (((((::[[[[))))):::::::]]]] - 1 records total
Structure:  (((((::[[[[)))))::::::]]]]
Organism Sequence ID# ID Notes
X13063 Beet Western-Yellows Virus CGCGGCACCGTCCGCGGAACAAACGG RP0081 81 PKB-number: PKB2 Modification: 1999-6-21 Definition: Orf2-orf3 ribosomal f More ...
Summary for Structure (((((::[[[[)))))::::::]]]] - 1 records total
Structure:  (((((::[[[[[))))):::::::]]]]]
Organism Sequence ID# ID Notes
NC_007193 Chaetoceros salsugineum CTGGAGGAACAATCCAGCGGATATTTGTT RP0361 361 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
Summary for Structure (((((::[[[[[))))):::::::]]]]] - 1 records total
Structure:  (((((::[[[[[[))))):::::::::::]]]]]]
Organism Sequence ID# ID Notes
M25381 Feline Immunodeficiency Virus GGGGCGAGCTGCAGCCCCAGTGAATCAAATGCAGC RP0083 83 PKB-number: PKB4 Definition: Gag-pol ribosomal frameshift site of Feline Imm More ...
Summary for Structure (((((::[[[[[[))))):::::::::::]]]]]] - 1 records total
Structure:  (((((:[[))))):::::::::::::]]
Organism Sequence ID# ID Notes
HIV K03455 CTTCTGGGAAGTTCAATTAGGAATACCA RP0595 595 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[))))):::::::::::::]] - 1 records total
Structure:  (((((:[[[))))):::::::::]]]
Organism Sequence ID# ID Notes
NC_009597 Pyrococcus abyssi virus CCTCGACCTTGAGGGAATGCTAAAGG RP0332 332 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
Summary for Structure (((((:[[[))))):::::::::]]] - 1 records total
Structure:  (((((:[[[)))))::::::]]]
Organism Sequence ID# ID Notes
NC016157 Human papillomavirus CCTTTATCTGAGGGTCTACCAGA RP0660 660 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure (((((:[[[)))))::::::]]] - 1 records total
Structure:  (((((:[[[))))):::::]]]
Organism Sequence ID# ID Notes
X16378 turnip yellow mosaic virus CCCTCTTCCGAGGGTCATCGGA RP0512 512 Computational James F. Lynn 06/05/2010 KSPOS
pdb 1A60 Chain A, Nmr Structure Of A Classical Pse CCCTTTTCCGAGGGTCATCGGA RP0558 558 >pdb|1A60|A Chain A, Nmr Structure Of A Classical Pseudoknot: Interplay Of Sin More ...
AF035403 Turnip yellow mosaic Blue Lake isolat CCCTTTTCCGAGGGTCATCGGA RP0559 559 >gb|AF035403.1| Turnip yellow mosaic Blue Lake isolate, complete genome Length= More ...
TYU88850 Turnip yellow mosaic virus variant Q18 CCCTTTTCCGAGGGTCATCGGA RP0560 560 >gb|U88850.1|TYU88850 Turnip yellow mosaic virus variant Q18, virion protein (V More ...
M58313 Andean potato latent virus CCCTTTTCCGAGGGTCATCGGA RP0561 561 >gb|M58313.1|EMVRRLSZ Andean potato latent virus (APLV) 3' terminus tRNA-like s More ...
Page summary 13 - records total

Sequence to Structure Report

Summary for Structure (((((:[[[))))):::::]]] - 5 records total
Structure:  (((((:[[[)))))::::]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus GTTGAAGGCTCAACATGGGCT RP0668 668 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure (((((:[[[)))))::::]]] - 1 records total
Structure:  (((((:[[[))))):::]]]
Organism Sequence ID# ID Notes
H1N1 HA HM624086 GTGCTATGGGGCATTCACCA RP0645 645 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
Summary for Structure (((((:[[[))))):::]]] - 1 records total
Structure:  (((((:[[[[))))):::]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus GGTTGTGCTCCAGCCTTAGGGC RP0671 671 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure (((((:[[[[))))):::]]]] - 1 records total
Structure:  (((((:[[[[:))))):::::::::::::::::::::::::::::::::::::::]]]]
Organism Sequence ID# ID Notes
HIV K03455 CTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAG RP0609 609 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[[[:))))):::::::::::::::::::::::::::::::::::::::]]]] - 1 records total
Structure:  (((((:[[[[:)))))::]]]]
Organism Sequence ID# ID Notes
HIV K03455 TGCAGGGCCTATTGCACCAGGC RP0585 585 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[[[:)))))::]]]] - 1 records total
Structure:  (((((:[[[[::::)))))::]]]]
Organism Sequence ID# ID Notes
HIV K03455 TAAGCCTCAATAAAGCTTGCCTTGA RP0580 580 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
HIV K03455 TAAGCCTCAATAAAGCTTGCCTTGA RP0635 635 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[[[::::)))))::]]]] - 2 records total
Structure:  (((((:[[[[[::))))):::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TATGATCAGATACTCATAGAAATCTG RP0593 593 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[[[[::))))):::]]]]] - 1 records total
Structure:  (((((:[[[[[[)))))::::::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 AGCTTAAGAATGAAGCTGTTAGACATTTT RP0611 611 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((:[[[[[[)))))::::::]]]]]] - 1 records total
Structure:  (((((:[[[[[[::))))):::::]]]]]]
Organism Sequence ID# ID Notes
U68074 E.coli CGAGGGGCGGTTGGCCTCGTAAAAAGCCGC RP0174 174 PKB-number: PKB49 Definition: Pseudoknot PK1 of E.coli tmRNA Organism: E.coli More ...
GU979419 Spissistilus festinus virus GCGCCCCTTTGGGGGGCGCAAAGTCCAAAG RP0530 530 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure (((((:[[[[[[::))))):::::]]]]]] - 2 records total
Page summary 11 - records total

Sequence to Structure Report

Structure:  (((((:[[[[[[[)))))::::::::::::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
DQ399707 Xenotropic MuLV TCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGC RP0659 659 >gi|88765817|gb|DQ399707.1| Xenotropic MuLV-related virus VP62, complete genome More ...
Summary for Structure (((((:[[[[[[[)))))::::::::::::::::::::::]]]]]]] - 1 records total
Structure:  (((((:[[[[[[[))))):::::::]]]]]]]
Organism Sequence ID# ID Notes
X12460 T2 bacteriophage TGACCAGCTATGAGGTCATACATCGTCATAGC RP0206 206 PKB-number: PKB73
Definition: Pseudoknot of the regulatory region of bacterio More ...
Summary for Structure (((((:[[[[[[[))))):::::::]]]]]]] - 1 records total
Structure:  (((((:[[[[[[[:)))))::::::::]]]]]]]
Organism Sequence ID# ID Notes
AF033807 mouse mammary tumor viru GGGGCAGTCCCCTAGCCCCGCTCAAAAGGGGGAT RP0210 210 PKB-number: PKB80
Definition: Gag/pro ribosomal frameshift site of mouse mamm More ...
Summary for Structure (((((:[[[[[[[:)))))::::::::]]]]]]] - 1 records total
Structure:  ((((...[[[[))))....]]]]
Organism Sequence ID# ID Notes
X78602 peanut clump virus CGCTGAAACGGAGCGATATCCGT RP0563 563 PKB-number PKB33 Definition:tRNA-like structure 3'end pseudoknot of RNA1 X78602 More ...
Summary for Structure ((((...[[[[))))....]]]] - 1 records total
Structure:  ((((:::(((((:[[[[[))))):::)))):::::::::::]]]]]
Organism Sequence ID# ID Notes
U68074 E.coli GCGTGGAAGCCCTGCCTGGGGTTGAAGCGTTAAAACTTAATCAGGC RP0176 176 PKB-number: PKB51 Definition: Pseudoknot PK3 of E.coli tmRNA Organism: E.coli More ...
Summary for Structure ((((:::(((((:[[[[[))))):::)))):::::::::::]]]]] - 1 records total
Structure:  ((((::::::::::::::[[:[[:)))):::::]]:]]
Organism Sequence ID# ID Notes
AY765383 Brachyteles arachnoides prion CATGGTGGTGGCTGGGGGCAACCCCATGGTGGCGGCTG RP0650 650 >gb|AY765383.1| Brachyteles arachnoides prion protein (PrP) gene, partial cdsSe More ...
U15164 APU15164 Ateles paniscus CATGGTGGTGGCTGGGGGCAACCCCATGGTGGCGGCTG RP0653 653 >gb|U15164.1|APU15164 Ateles paniscus x Ateles fusciceps major prion protein pr More ...
Summary for Structure ((((::::::::::::::[[:[[:)))):::::]]:]] - 2 records total
Structure:  ((((::::::::::::::[[[[[:)))):::::]]]]]
Organism Sequence ID# ID Notes
U08309 geoffroyi prion CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG RP0307 307 >gi|474376|gb|U08309.1|AGU08309 Ateles geoffroyi prion protein gene, partial cd More ...
NM_000311.3| Homo sapiens prion CATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTG RP0313 313 computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho More ...
NM_000311.3| Homo sapiens prion protein CATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTG RP0314 314 computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho More ...
NM_000311 Homo sapiens prion protein CATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTG RP0315 315 computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho More ...
NM_000311.3| Homo sapiens prion protein CATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTG RP0316 316 computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho More ...
AY765383 Brachyteles arachnoides prion CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG RP0651 651 >gb|AY765383.1| Brachyteles arachnoides prion protein (PrP) gene, partial cdsSe More ...
U15164 APU15164 Ateles paniscus CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG RP0652 652 >gb|U15164.1|APU15164 Ateles paniscus x Ateles fusciceps major prion protein pr More ...
U08309 AGU08309 Ateles geoffroyi prion CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG RP0654 654 >gb|U08309.1|AGU08309 Ateles geoffroyi prion protein gene, partial cdsSeq compa More ...
U08309 AGU08309 Ateles geoffroyi prion CATGGTGGCGGCTGGGGACAGCCTCATGGTGGTGGCTG RP0655 655 >gb|U08309.1|AGU08309 Ateles geoffroyi prion protein gene, partial cdsSeq compa More ...
XM_002747325 Callithrix jacchus CATGGTGGCGGCTGGGGACAGCCCCATGGTGGCGGCTG RP0656 656 >ref|XM_002747325.1| PREDICTED: Callithrix jacchus major prion protein-like, tr More ...
Page summary 17 - records total

Sequence to Structure Report

Summary for Structure ((((::::::::::::::[[[[[:)))):::::]]]]] - 10 records total
Structure:  ((((:::::::::::[[[[[:)))):::::]]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus GAGGACACCACCACCGGGGAACCTTCCACCTCCCT RP0665 665 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((:::::::::::[[[[[:)))):::::]]]]] - 1 records total
Structure:  ((((::::::::::[[[[[[:::))))::::::::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 CAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTT RP0599 599 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((::::::::::[[[[[[:::))))::::::::]]]]]] - 1 records total
Structure:  ((((::::::::[[[[[[::)))):::::::]]]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus CTACAAATATTTCTGTGCAGGTAGAGACAGAGCATAG RP0661 661 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((::::::::[[[[[[::)))):::::::]]]]]] - 1 records total
Structure:  ((((::::::[[[[[[[[))))::]]]]]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus AGCCTTTGTACCGGGAGTGGTTGCATTTTTGG RP0674 674 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((::::::[[[[[[[[))))::]]]]]]]] - 1 records total
Structure:  ((((:::::[[[))))::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im TTTGTTTCATAACAAAAGCCTTA RP0117 117 M0017
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
NC_009597 Pyrococcus abyssi virus GCCCGTTCAAGGGGGCTCAGCCT RP0297 297 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_007014 Small anellovirus 2 ACCTGGAGGAGGAGGTTTTGCCT RP0369 369 method: computational James F. Lynn 10-25-09 >gi|66391753|ref|NC_007014.1| Small More ...
NC_001427 Chicken anemia virus CCCCCCCCTGGGGGGGATTCCCC RP0382 382 method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke More ...
52352969 ebolavirus ATTGATGGCCAGCAATTCCTCTG RP0390 390 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus GAAATTTTTCTTTTTCATTGAAG RP0401 401 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
AF418014 Australian bat lyssavirus TTGGGTCTCCATCCAAAATCATG RP0444 444 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
GU979419 Spissistilus festinus virus CACACCCACCCGTGTGTGTTCGG RP0529 529 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((:::::[[[))))::::]]] - 8 records total
Structure:  ((((:::::[[[[))))::::::::::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 AGACCTCCAGTGGGTCTCTAGGGGCACACCCAC RP0112 112 M0012 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((:::::[[[[)))): More ...
DQ249299 Duck hepatitis virus AATTTACTTTTTCAATTGATGAAAATTGTGAAA RP0272 272 >gi|82468324|gb|DQ249299.1| Duck hepatitis virus 1 strain 03D, complete sequenc More ...
DQ249299 Duck hepatitis virus CAGGTACCATAAACCTGTTTTTCCTGGGTTTTA RP0273 273 >gi|82468324|gb|DQ249299.1| Duck hepatitis virus 1 strain 03D, complete sequenc More ...
NC_009597 Pyrococcus abyssi virus TTTCTCGTCGGAAGAAAATATGCTGAGCTTTCC RP0296 296 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
AF085363 CTCTTTTTAAATTAGAGACAATTTGAACTAATT RP0328 328 computational-sequence comparison James F. lynn 08-19-2009 AF085363 ~7286-7411
M16560 CTCTTTTTAAATTAGAGACAATTTGAACTAATT RP0327 327 computational-sequence comparison James F. lynn 08-19-2009 >M16560/7270-7389
Page summary 18 - records total

Sequence to Structure Report

AY302556 Human echovirus 33 CTCCTTCTAAATTGGAGACAATTTGAAATAATT RP0330 330 computational-sequence comparison James F. lynn 08-19-2009 >AY302556 ~7274-7394
AF241359 CTCTTTTTAAATTAGAGACAATTTGAAATAATT RP0321 321 computational-sequence comparison James F. lynn 08-19-2009 >AF241359 ~7291-7411
GU979419 Spissistilus festinus virus AACCTGAATCCCAGGTTGATGAAGCGGGATGGG RP0531 531 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((:::::[[[[))))::::::::::::]]]] - 9 records total
Structure:  ((((:::::[[[[)))):::]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGTGGAGATGGGGCACCATGCTCC RP0616 616 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((:::::[[[[)))):::]]]] - 1 records total
Structure:  ((((:::::[[[[[))))::::::]:]]]]
Organism Sequence ID# ID Notes
J02415 tobacco mosaic virus AGTGTTTTTCCCTCCACTTAAATCGAAGGG RP0180 180 PKB-number: PKB55 Definition: Pseudoknot PK3 of the upstream pseudoknot domain More ...
U34586 odontoglossum ringspot virus AGTGTTTGTCCCTCCACTTAAATCGAAGGG RP0183 183 PKB-number: PKB58 Definition: Pseudoknot PK3 of the upstream pseudoknot domain More ...
U34586 odontoglossum ringspot virus AGTGTTTATCCCTCCACTTGAATCGAAGGG RP0185 185 PKB-number: PKB60 Definition: Pseudoknot PK3 of the upstream pseudoknot domain More ...
U34586 odontoglossum ringspot virus AGTGGTTATCCCTCCACTTAAATCGAAGGG RP0203 203 PKB-number: PKB62 Definition: Pseudoknot PK3 of the upstream pseudoknot domain More ...
X02144 tobacco mosaic virus AGTGTTTTTCCCTCCACTTAAATCGAAGGG RP0214 214 PKB-number: PKB84
Definition: Pseudoknot PK3 of the upstream pseudoknot domai More ...
Summary for Structure ((((:::::[[[[[))))::::::]:]]]] - 5 records total
Structure:  ((((::::[[[[))))::]]]]
Organism Sequence ID# ID Notes
HIV K03455 CCAGATCTGAGCCTGGGAGCTC RP0579 579 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
HIV K03455 CCAGATCTGAGCCTGGGAGCTC RP0634 634 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((::::[[[[))))::]]]] - 2 records total
Structure:  ((((::::[[[[[[))))::::::::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 CCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGC RP0606 606 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((::::[[[[[[))))::::::::]]]]]] - 1 records total
Structure:  ((((:::[[[))))::::]]]
Organism Sequence ID# ID Notes
H1N1 HA HM624086 GAGCAATTGAGCTCAGTGTCA RP0644 644 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
Summary for Structure ((((:::[[[))))::::]]] - 1 records total
Structure:  ((((:::[[[:::)))):::::::::]]]
Organism Sequence ID# ID Notes
A07108 HIV GATTGTTTTTCAGAATCTGCTATAAGAAA RP0014 14 >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
DQ192570 Crow polyomavirus AGCATCCCCCAGCTGCTTCAGGTGCAGGG RP0271 271 >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational J More ...
NC_007193 Chaetoceros salsugineum CCTCCTCGTTATCGAGGAGGCTTCAGAAC RP0360 360 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
52352969 ebolavirus AAGGTACTGGGACCCTTACTGTCCCTCCA RP0393 393 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus CAAAAGTATACTGTTTGAACCCCTAGTAT RP0399 399 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
Page summary 18 - records total

Sequence to Structure Report

52352969 ebolavirus TTCAGACATTGCGTGAACTCCTCCTTAAT RP0400 400 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus TGAAACAAGATCCTTCACAACCCACTTCT RP0405 405 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus TATCGATTATGTTGATAATGTAAATAATA RP0407 407 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
GU979419 Spissistilus festinus virus CCCGAGCCATATACGGGGTCGAGCCCATG RP0532 532 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus GCCTAGAAAAGTGAGGCAAGGGATGTTTT RP0533 533 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((:::[[[:::)))):::::::::]]] - 10 records total
Structure:  ((((:::[[[[)))):::::::::]]]]
Organism Sequence ID# ID Notes
X82130 Odontoglossum ringspot virus TAAAAAGAAATTTTAACTCTCCAGATTT RP0197 197 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
NC_012958 Drosophila A virus TTGCACTCCCTGCAAGGGACACAGAGGG RP0342 342 method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr More ...
NC_003871 Carrot red leaf luteovirus TAGTATTTTATACTAACTCTAGGAATAA RP0350 350 method: computational James F. Lynn 10-24-2009 >gi|20889313|ref|NC_003871.1| Car More ...
Summary for Structure ((((:::[[[[)))):::::::::]]]] - 3 records total
Structure:  ((((:::[[[[)))):::::]]]]
Organism Sequence ID# ID Notes
AP000545 Homo sapiens TTTTAAATTTTAAAAGCATCAAAA RP0221 221 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
DQ113897.1| Adult diarrheal rotavirus AAGCGTTCTTTGCTTATGAAAAAG RP0285 285 >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
NC_009597 Pyrococcus abyssi virus TCGGAACTGGCCCGAACAATGCCA RP0298 298 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_012126 California sea lion anellovirus TTTTCAACAACAAAATCCTGGTTG RP0364 364 method: computational James F. Lynn 10-25-09 >gi|224504298|ref|NC_012126.1| Cali More ...
Summary for Structure ((((:::[[[[)))):::::]]]] - 4 records total
Structure:  ((((:::[[[[))))::::]]]]
Organism Sequence ID# ID Notes
X78602 peanut clump virus CGCTGAAACGGAGCGATATCCGT RP0511 511 X78602 peanut clump virus KSPOS Computational James F. Lynn 06/05/2010
Summary for Structure ((((:::[[[[))))::::]]]] - 1 records total
Structure:  ((((:::[[[[)))):::]]]]
Organism Sequence ID# ID Notes
NC_000962 Mycobacterium tuberculosis AGGCCATCGCCGCCTACCGGCG RP0515 515 >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu More ...
NC_000962 Mycobacterium tuberculosis CGGCGCTGGTGGCCGCCTCACC RP0516 516 >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu More ...
NC_000962 Mycobacterium tuberculosis CGGCGACTGGGGCCGCACCCCA RP0517 517 >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu More ...
NC_000962 Mycobacterium tuberculosis GCCACCGAGCCTGGCAGGGGCT RP0518 518 >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu More ...
NC_000962 Mycobacterium tuberculosis CTGCGCGGCGAGCAGACATCGC RP0519 519 >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu More ...
NC_000962 Mycobacterium tuberculosis AGCGCTGTCCCCGCTATCGGGA RP0520 520 >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu More ...
NC_000962 Mycobacterium tuberculosis CCGGACCGCCGCCGGGTCCGGC RP0521 521 >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu More ...
AP010918 Mycobacterium bovis AGGCCATCGCCGCCTACCGGCG RP0522 522 >dbj|AP010918.1| Mycobacterium bovis BCG str. Tokyo 172 DNA, complete genome Le More ...
CP001798 Nitrosococcus halophilus AGGCCATTGCCGCCTATCGGCG RP0523 523 >gb|CP001798.1| Nitrosococcus halophilus Nc4, complete genome Length=4079427 MS More ...
Page summary 22 - records total

Sequence to Structure Report

CP000717 Mycobacterium tuberculosis AGGCCATTGCCGCCTATCGGCG RP0528 528 >gb|CP000717.1| Mycobacterium tuberculosis F11, complete genome Length=4424435 More ...
Structure:  ((((:::[[[[)))):::]]]]
Organism Sequence ID# ID Notes
AM408590 Mycobacterium bovis AGGCCATTGCCGCCTATCGGCG RP0540 540 >emb|AM408590.1| Mycobacterium bovis BCG Pasteur 1173P2, complete genome Length More ...
Summary for Structure ((((:::[[[[)))):::]]]] - 1 records total
AE000516 Mycobacterium tuberculosis AGGCCATTGCCGCCTATCGGCG RP0541 541 >gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length=4403 More ...
HIV K03455 GGATAGAGTGCATCCAGTGCAT RP0584 584 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((:::[[[[)))):::]]]] - 12 records total
Structure:  ((((:::[[[[:)))):::::]]]]
Organism Sequence ID# ID Notes
AP000545 Homo sapiens GGGAGTTTGTTTTCCCTTTTGAACA RP0238 238 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens ATATATGTAAATATATTCTCTTTTA RP0240 239 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens ATATATATATATATATATACATATA RP0240 240 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TTTTGCTTTAATAAAAATTCCTTAA RP0241 241 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TGGAGTGTGCTCTCCAGGATCAGCA RP0242 242 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
52352969 ebolavirus TGTTGAGATAGGAACACCAAGCTAT RP0398 398 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
Summary for Structure ((((:::[[[[:)))):::::]]]] - 6 records total
Structure:  ((((:::[[[[::)))):::::]]]]
Organism Sequence ID# ID Notes
AP000545 Homo sapiens TTTTAGGAAAATAAAAAACATATTTT RP0229 229 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
NC_001782 Saccharomyces cerevisiae killer virus GTATCAAGGCCTCATACTGTATGGCC RP0334 334 method: computational James F. Lynn 10-23-2009 >gi|9629210|ref|NC_001782.1| Sacc More ...
52352969 ebolavirus ATCACCTAATGAGTGATGAGCCCATT RP0389 389 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
Summary for Structure ((((:::[[[[::)))):::::]]]] - 3 records total
Structure:  ((((:::[[[[:::)))):::::::::]]]]
Organism Sequence ID# ID Notes
DQ113899.1| Adult diarrheal rotavirus AAGCAGCTTCATCAGCTTTTAAAAAAGTGAA RP0281 281 >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computat More ...
CP000473 TGGTTAACTGCGAGACCAACAAGTCGAGCAG RP0319 319 computational-sequence comparison James F. lynn 08-19-2009 CP000473/~1252545-12 More ...
AY584522 AGCTTGACTGCAAGAGCTACAACTCAAGCAG RP0320 320 computational-sequence comparison James F. lynn 08-19-2009 AY584522/~1870-1977
CP000473 TGGTTAACTGCGAGACCAACAAGTCGAGCAG RP0311 311 computational-sequence comparison James F. lynn 08-19-2009 CP000473/~1252545-12 More ...
AY584522 AGCTTGACTGCAAGAGCTACAACTCAAGCAG RP0312 312 computational-sequence comparison James F. lynn 08-19-2009 ((((:::[[[[:::)))): More ...
NC_003871 Carrot red leaf luteovirus TCGCTAAAGAGGCAGCGATGGAAGCAGCTCT RP0349 349 method: computational James F. Lynn 10-24-2009 >gi|20889313|ref|NC_003871.1| Car More ...
NC_007193 Chaetoceros salsugineum AAAGGGTGGAACTGCTTTGGATCATCTTTCC RP0357 357 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
NC_007193 Chaetoceros salsugineum ACAGCACGTAGAAACTGTACCAGGAGCCTAC RP0358 358 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
Page summary 21 - records total

Sequence to Structure Report

Summary for Structure ((((:::[[[[:::)))):::::::::]]]] - 8 records total
Structure:  ((((:::[[[[::::)))):::::]]]]
Organism Sequence ID# ID Notes
AP000545 Homo sapiens AAATAAAAAGTTATTATTTATATTACTT RP0228 228 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
Summary for Structure ((((:::[[[[::::)))):::::]]]] - 1 records total
Structure:  ((((:::[[[[[)))):::::]]]]]
Organism Sequence ID# ID Notes
AP000545 Homo sapiens TTTTAGGAAAATAAAAAACATATTTT RP0220 220 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
Summary for Structure ((((:::[[[[[)))):::::]]]]] - 1 records total
Structure:  ((((:::[[[[[::))))::::::::::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GCTACTTCCCTGATTAGCAGAACTACACACCAGGG RP0630 630 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((:::[[[[[::))))::::::::::::]]]]] - 1 records total
Structure:  ((((::[[:::::)))):::::]]
Organism Sequence ID# ID Notes
NC_001866 Avian myelocytomatosis virus GGACAGTGGCAGGGTCCTCAAACA RP0639 639 >gi|9629900|ref|NC_001866.1| Avian myelocytomatosis virus, complete genome 3392 More ...
Summary for Structure ((((::[[:::::)))):::::]] - 1 records total
Structure:  ((((::[[[))))::::::::::]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 TGGTCCATAACCAGATTGTCACCTAT RP0114 114 M0014Bovine Leukemia Virus AF033818James F. Lynn 12-25-08
AAVN02000007 CGGTCGGCAACCGTCCTTTTGAATGC RP0309 309 >AAVN02000007 ~7607 computational-sequence comparison James F. lynn 08-19-2009 ( More ...
AY584518 TGTAAGACCTACAAGTCGAGCAGGGT RP0310 310 computational-sequence comparison James F. lynn 08-19-2009
AAVN02000007 CGGTCGGCAACCGTCCTTTTGAATGC RP0317 317 >AAVN02000007 ~7607 computational-sequence comparison James F. lynn 08-19-2009
AY584518 TGTAAGACCTACAAGTCGAGCAGGGT RP0318 318 computational-sequence comparison James F. lynn 08-19-2009 AY584518 -1983
NC_013116 Sclerotinia sclerotiorum hypovirulence a GGGGAGGGGCCCCCTGGGGGGGACCC RP0337 337 method: computational James F. Lynn 10-23-2009 >gi|256352170|ref|NC_013116.1| Sc More ...
NC_012958 Drosophila A virus GTGGGTCCTCCACCATCTCAGAAAGG RP0341 341 method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr More ...
NC_007193 Chaetoceros salsugineum GGCCCCATCGGCCCTGTGGGTAGGAT RP0356 356 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
NC_001427 Chicken anemia virus TACGTCACGCGTACAGGGGGGTACGT RP0378 378 method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke More ...
52352969 ebolavirus ATTGGCAATCAATAAACCTCTTGATT RP0402 402 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
GU979419 Spissistilus festinus virus CTTCCCCATGAAGGTGGTAGCGTATG RP0542 542 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((::[[[))))::::::::::]]] - 11 records total
Structure:  ((((::[[[)))):::::::]]]
Organism Sequence ID# ID Notes
DQ192570 Crow polyomavirus AGTGCCATTCACTGAATTTAAAT RP0414 414 >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Jam More ...
Summary for Structure ((((::[[[)))):::::::]]] - 1 records total
Page summary 16 - records total

Sequence to Structure Report

Structure:  ((((::[[[:))))::::::::::]]]
Organism Sequence ID# ID Notes
A07108 HIV TCAACTGCTGTTGAATGGCAGTCTAGC RP0003 3 >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA James F.Lynn More ...
X82130 Odontoglossum ringspot virus AAATCTCTGAATTTATTAATTTATCAG RP0265 265 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
NC_009597 Pyrococcus abyssi virus CTTATTCCTATAAGTCAATAGAAAAGG RP0289 289 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_009597 Pyrococcus abyssi virus GAAGGCCAAGCTTCAAGAGTGAATTTG RP0290 290 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_009597 Pyrococcus abyssi virus CTTATTCCTATAAGTCAATAGAAAAGG RP0299 299 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_009597 Pyrococcus abyssi virus GAAGGCCAAGCTTCAAGAGTGAATTTG RP0300 300 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_012958 Drosophila A virus TATCACTCCAGATACTGGTTTCCAGGA RP0346 346 method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr More ...
NC_001653 Hepatitis delta virus ACCGTCCCCTCGGTAATGGCGAATGGG RP0353 353 method: computational James F. Lynn 10-23-2009 >gi|13277517|ref|NC_001653.2| Hep More ...
NC_003410 Canary circovirus CCCCCGTCGAGGGGCCGAAGGCCCCGA RP0375 375 method: computational James F. Lynn 10-25-09 >gi|18875309|ref|NC_003410.1| Canar More ...
52352969 ebolavirus CTTGCCCCCCCAAGCGTTAATGAAGGG RP0385 385 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus CTGTCCTGCCACAGGAGTCCACAAGCA RP0392 392 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus CTTGCCCCCCCAAGCGTTAATGAAGGG RP0396 396 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus CTGTCCTGCCACAGGAGTCCACAAGCA RP0384 384 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
Australian bat lyssavirus AF418014 ATTTTATCAAAAATCTTCCCCTATTGA RP0433 433 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
Chayote yellow mosaic virus NC_004618 GTGGTCCCGCCCACTATCCGATGTCGG RP0438 438 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu More ...
Chayote yellow mosaic virus NC_004618 CTATCTTGAAATAGAGGGGATTTGTCA RP0439 439 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu More ...
GU979419 Spissistilus festinus virus ATAAGCCGGGTTATCAATCAGCCACCG RP0525 525 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus GGTTCAGCGCAACCCGGCCCTGCTCGC RP0526 526 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
FM865409 Homo sapiens neanderthalensis AGCCTTCATAGGCTATGTCCTCCCATG RP0569 569 >gi|253947317|emb|FM865409.1| Homo sapiens neanderthalensis complete mitochondri More ...
FM865411 Homo sapiens neanderthalensis AGCCTTCATAGGCTATGTCCTCCCATG RP0565 565 >gi|253947345|emb|FM865411.1| Homo sapiens neanderthalensis complete mitochondri More ...
Structure:  ((((::[[[:))))::::::::::]]]
Organism Sequence ID# ID Notes
FM865410 Homo sapiens neanderthalensis AGCCTTCATAGGCTATGTCCTCCCATG RP0567 567 >gi|253947331|emb|FM865410.1| Homo sapiens neanderthalensis complete mitochondri More ...
Summary for Structure ((((::[[[:))))::::::::::]]] - 1 records total
FM865408 Homo sapiens neanderthalensis AGCCTTCATAGGCTATGTCCTCCCATG RP0572 572 >gi|253947303|emb|FM865408.1| Homo sapiens neanderthalensis complete mitochondri More ...
Summary for Structure ((((::[[[:))))::::::::::]]] - 21 records total
Structure:  ((((::[[[:)))):::::::::]]]
Organism Sequence ID# ID Notes
A07108 HIV AAAGTTGTCCCTTTGACTGACACGAC RP0002 2 >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 More ...
Y07496 potato leafroll virus GCGGCACCGCCCGCCAAAACAAACGG RP0167 167 PKB-number: PKB42
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymeras More ...
DQ113897.1| Adult diarrheal rotavirus TCTATATCAGTAGAAGATAAAATTGA RP0286 286 >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
Page summary 25 - records total

Sequence to Structure Report

NC_009597 Pyrococcus abyssi virus CCTCGACCTTGAGGGAATGCTAAAGG RP0323 322 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_001782 Saccharomyces cerevisiae killer virus TATGCATTGACATATAGCAGGTACAA RP0335 335 method: computational James F. Lynn 10-23-2009 >gi|9629210|ref|NC_001782.1| Sacc More ...
NC_007193 Chaetoceros salsugineum TTGTGGCGATACAAGCAGGGCTATCG RP0340 340 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
NC_001427 Chicken anemia virus GCAGATGACCCTGCAAGACATGGGTC RP0380 380 method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke More ...
NC_007013 Small anellovirus 1 AAAATATTTCTTTTACAGATGCAAAA RP0365 365 method: computational James F. Lynn 10-25-09 >gi|66391749|ref|NC_007013.1| Small More ...
NC_001944 Beak and feather disease virus CGAAATCGAATTCGTCCGTTCTCTCG RP0370 370 method: computational James F. Lynn 10-25-09 >gi|9630729|ref|NC_001944.1| Beak a More ...
52352969 ebolavirus AGGATGTTTGTCCTACTCTCAGAAAA RP0394 394 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus ATTACTCCGGTAATATTGTGCATCGG RP0404 404 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus GACACTCAAGTGTCATGTCCAGGTTG RP0406 406 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
GU979419 Spissistilus festinus virus GCAGCCTGGGCTGCTCTGCGCTCCCA RP0539 539 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((::[[[:)))):::::::::]]] - 13 records total
Structure:  ((((::[[[:))))::::::::]]]
Organism Sequence ID# ID Notes
A04321|HIVLAIJ19 GCTGAGCCAGCAGCAGATGGGGTGG RP0001 1 >A04321|HIVLAIJ19 H0001 James F.Lynn 01-06-09 KSNEG:GCTGAGCCAGCAGCAGATGGggtgg More ...
DQ113899.1| Adult diarrheal rotavirus AATGAAAATTCATTGATTAACTATT RP0280 280 >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computat More ...
NC_009597 Pyrococcus abyssi virus CCTGAAAGAACAGGGGAAGGTCTCT RP0323 323 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_012958 Drosophila A virus GGGGCACTGTCCCCGCCAGGTGCAG RP0343 343 method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr More ...
NC_002068 Bovine circovirus ACTTTTAATAAAGTGAAGTGGTATT RP0372 372 method: computational James F. Lynn 10-25-09 >gi|9631282|ref|NC_002068.1| Bovine More ...
NC_003410 Canary circovirus CAAATAAATGTTTGGTGTCTTTATT RP0376 376 method: computational James F. Lynn 10-25-09 >gi|18875309|ref|NC_003410.1| Canar More ...
NC_001427 Chicken anemia virus ACCATCGGCATGGTGGAGATGGGCC RP0379 379 method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke More ...
52352969 ebolavirus TAAGTCACAGCTTAGTCAATTATGT RP0395 395 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus CAAACTCCCATTTGGGCCTTGAGGG RP0397 397 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus CCTGTAACTTCAGGCCTATTTCAGT RP0403 403 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
Summary for Structure ((((::[[[:))))::::::::]]] - 10 records total
Structure:  ((((::[[[:)))):::]]]
Organism Sequence ID# ID Notes
A04321 HIVLAIJ19 GCTGAGCCAGCAGCAGATGG RP0510 510 Computational KSPOS James F. Lynn 06/05/2010 present in all hiv genomes
Summary for Structure ((((::[[[:)))):::]]] - 1 records total
Structure:  ((((::[[[::)))):::::::::::]]]
Organism Sequence ID# ID Notes
A07108 HIV CAAAGGTATCCTTTGAGCCAATTCCCATA RP0018 18 >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
DQ113898.1| Adult diarrheal rotavirus AAGCTCCTGATGCTTTTGATTGGTCACAG RP0284 284 >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computati More ...
CP000511 AGGTTCCCTCAACCTGGACGGCAATCAGG RP0304 304 >CP000511 ~3501682 computational-sequence comparison James F. lynn 08-19-2009
Page summary 24 - records total

Sequence to Structure Report

BX842576 AGGTTCCCTCAACCTGGACGGCAATCAGG RP0305 305 >BX842576/93135-93242 computational-sequence comparison James F. lynn 08-19-2009
AM711867 AGGTTCCCTCAACCTGGTTGGTAATCAGG RP0307 306 >AM711867 computational-sequence comparison James F. lynn 08-19-2009 -2868776
AM711867 AGGTTCCCTCAACCTGGTTGGTAATCAGG RP0308 308 computational-sequence comparison James F. lynn 08-19-2009 ((((::[[[::)))):::::: More ...
NC_009597 Pyrococcus abyssi virus TTGAGAGAATGTCAAGAATCTTTTGTTTC RP0324 324 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_012958 Drosophila A virus ACCACCTCAGATGGTTCTTGGAACAGTGA RP0347 347 method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr More ...
52352969 ebolavirus CAGTAAACTACACTGAAAATACATCAAGT RP0391 391 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
GU979419 Spissistilus festinus virus AGGGTTCCCCCCCCTCCTCCCCCCAAGGG RP0534 534 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus AGGGCTGCATTCCCTAAGTGGATAGGTGC RP0536 536 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus TGCCTATGGTTGGCATACAGGCCCCACCA RP0537 537 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus AGGGTGCCCACCCCTACTAACGCACTGGG RP0535 535 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus ACCTGAATCCCAGGTTGATGAAGCGGGAT RP0538 538 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((::[[[::)))):::::::::::]]] - 14 records total
Structure:  ((((::[[[::))))::::::::::]]]
Organism Sequence ID# ID Notes
A07108 HIV GCACCACTAATGTGCCCTGGAACTCTAG RP0017 17 >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
GU979419 Spissistilus festinus virus GGGTTCTTGCAACCCGAGCTCCTTCCAA RP0545 545 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((::[[[::))))::::::::::]]] - 2 records total
Structure:  ((((::[[[::)))):::::::::]]]
Organism Sequence ID# ID Notes
A07108 HIV GGAATTTGGAATTCCCTACAATCCCCA RP0016 16 >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
NC_009597 Pyrococcus abyssi virus CCCGCCCACCTCGGGCCTCGTCTTGTG RP0325 325 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
Summary for Structure ((((::[[[::)))):::::::::]]] - 2 records total
Structure:  ((((::[[[::))))::]]]
Organism Sequence ID# ID Notes
CP000769 Anaeromyxobacter sp. AGGCCATCGACGCCTACCGG RP0557 557 >gb|CP000769.1| Anaeromyxobacter sp. Fw109-5, complete genome Length=5277990 M More ...
Summary for Structure ((((::[[[::))))::]]] - 1 records total
Structure:  ((((::[[[:::))))::::::::::]]]
Organism Sequence ID# ID Notes
X82130 Odontoglossum ringspot virus ACTGTTCAACAGCAGTTTGCTGATGTTTG RP0266 266 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
AF311938 ATTATATAATTTTAATTTTAATTGGCTTA RP0326 326 computational-sequence comparison James F. lynn 08-26-2009 >AF311938 ~7320-7445
NC_009597 Pyrococcus abyssi virus TATTGCAAGGGCAATAAGAACTGAGGCTT RP0331 331 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_013116 Sclerotinia sclerotiorum hypovirulence a AAGTTTGATAAGACTTGGACTATGCAATC RP0338 338 method: computational James F. Lynn 10-23-2009 >gi|256352170|ref|NC_013116.1| Sc More ...
NC_013116 Sclerotinia sclerotiorum hypovirulence a GTATATCGTCGAATACAGCGTATTCCACG RP0339 339 method: computational James F. Lynn 10-23-2009 >gi|256352170|ref|NC_013116.1| Sc More ...
NC_012126 California sea lion anellovirus CCTGGGCGGGTGCAGGAGGCCAAAGGCCG RP0363 363 method: computational James F. Lynn 10-25-09 >gi|224504298|ref|NC_012126.1| Cali More ...
Page summary 22 - records total

Sequence to Structure Report

NC_007013 Small anellovirus 1 AGGTTACTTTTCACCTAGAATACTACAAG RP0366 366 method: computational James F. Lynn 10-25-09 >gi|66391749|ref|NC_007013.1| Small More ...
Summary for Structure ((((::[[[:::))))::::::::::]]] - 7 records total
Structure:  ((((::[[[:::)))):::::::::]]]
Organism Sequence ID# ID Notes
A07108 HIV AGCCATTACACAGGCTTGTCCAAAGGTA RP0015 15 >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn More ...
CY043336.1| Influenza A virus AATCTCAATATGGATTAGCCACTCAATT RP0277 277 >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme More ...
DQ113898.1| Adult diarrheal rotavirus ATAAGAACAATTTTATCAAAAACTTTGT RP0283 283 >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computati More ...
NC_007193 Chaetoceros salsugineum ATGGACATTGTTCCATGATGATTAAAAT RP0359 359 method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
Summary for Structure ((((::[[[:::)))):::::::::]]] - 4 records total
Structure:  ((((::[[[[))))::::::::::::::::::::::::::::]]]]
Organism Sequence ID# ID Notes
HIV K03455 GCTGAGCCAGCAGCAGATAGGGTGGGAGCAGCATCTCGAGACCTGG RP0627 627 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((::[[[[))))::::::::::::::::::::::::::::]]]] - 1 records total
Structure:  ((((::[[[[)))):::::::::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 TGCAGGCTTGTGCACATTGGGCCCCCAAG RP0113 113 M0013 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((::[[[[)))):::: More ...
D00647.1|BLVGPE Bovine leukemia virus TGCAGGCTTGTGCACATTGGGCCCCCAAG RP0216 216 method: computational linguistic plus MSA BLAST James F. Lynn 08-04-2009
NC_001653 Hepatitis delta virus GGAGGCGGGCCTCCCGATCCGAGGGGCCC RP0352 352 method: computational James F. Lynn 10-23-2009 >gi|13277517|ref|NC_001653.2| Hep More ...
GU979419 Spissistilus festinus virus CCAAGGTGGGTTGGGTAGTCCCCCCCCCA RP0546 546 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure ((((::[[[[)))):::::::::::]]]] - 4 records total
Structure:  ((((::[[[[)))):::::::::]]]]
Organism Sequence ID# ID Notes
X82130 Odontoglossum ringspot virus AAATCTCTGAATTTATTAATTTATCAG RP0198 198 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
Summary for Structure ((((::[[[[)))):::::::::]]]] - 1 records total
Structure:  ((((::[[[[))))::::::::]]]]
Organism Sequence ID# ID Notes
D00530 potato leafroll virus GCGGCACCGTCCGCCAAAACAAACGG RP0168 168 PKB-number: PKB43
Definition: ORF2a/ORF2b (putative RNA-dependent RNA polymer More ...
X82130.1 Odontoglossum ringspot virus GCATACGATAATGCATAGTGGCTATC RP0199 199 >gi|558231|emb|X82130.1 Odontoglossum ringspot virus RNA for replicase, movemen More ...
X82130.1 Odontoglossum ringspot viru GTACACGATAGTACATAGTGTTTATC RP0200 200 >gi|558231|emb|X82130.1 Odontoglossum ringspot virus RNA for replicase, movemen More ...
Summary for Structure ((((::[[[[))))::::::::]]]] - 3 records total
Structure:  ((((::[[[[))))::::]]]]
Organism Sequence ID# ID Notes
X82130.1 Odontoglossum ringspot virus AAAGGACGATCTTTCGCGATCG RP0201 201 >gi|558231|emb|X82130.1 Odontoglossum ringspot virus RNA for replicase,
moveme More ...
NC_012958 Drosophila A virus CCACCCGTAAGTGGTATCTTAC RP0345 345 method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr More ...
Summary for Structure ((((::[[[[))))::::]]]] - 2 records total
Page summary 16 - records total

Sequence to Structure Report

Structure:  ((((::[[[[:::)))):::]]]]
Organism Sequence ID# ID Notes
NC_001866 Avian myelocytomatosis virus GGACAGTGTCAGAGTCCTGAGACA RP0637 637 >gi|9629900|ref|NC_001866.1| Avian myelocytomatosis virus, complete genome 3392 More ...
Summary for Structure ((((::[[[[:::)))):::]]]] - 1 records total
Structure:  ((((::[[[[[:::::)))):::::::::::::::::::::::::::::::::::::::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGC RP0582 582 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((::[[[[[:::::)))):::::::::::::::::::::::::::::::::::::::::]]]]] - 1 records total
Structure:  ((((::[[[[[[::))))::::::::::::::::::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGA RP0575 575 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((::[[[[[[::))))::::::::::::::::::]]]]]] - 1 records total
Structure:  ((((::[[[[[[:::::)))):::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TCCGAGATCTTCAGACCTGGAGGAGGAGAT RP0620 620 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((::[[[[[[:::::)))):::]]]]]] - 1 records total
Structure:  ((((::[[[[[[[[:)))):::::::]]]]]]]]
Organism Sequence ID# ID Notes
NC_010317 Abaca bunchy top virus GGGACATCACGTGCCTCCCTGTACACGCACGTGA RP0461 461 >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com More ...
Summary for Structure ((((::[[[[[[[[:)))):::::::]]]]]]]] - 1 records total
Structure:  ((((:[[[[))))::]]]]
Organism Sequence ID# ID Notes
HIV K03455 TCCCACTAGGGGATGCTAG RP0608 608 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((:[[[[))))::]]]] - 1 records total
Structure:  ((((:[[[[:))))::::::::]]]]
Organism Sequence ID# ID Notes
AF038398 Simian-HIV TTCAATCTAGTGAAGGACCCTATAGA RP0409 409 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
AF218039 Cricket paralysis virus TAAAAACAACTTTACTAAAATCTTGT RP0410 410 >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational 03-03-2 More ...
AF218039 Cricket paralysis virus TTTTAAATTTAAAATTTTAAATAATT RP0411 411 >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational 03-03-2 More ...
EU420138 Bat coronavirus ATAACTTGTCTTATGTGTTTACACAA RP0412 412 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
DQ192570 Crow polyomavirus AAAACTTTTTTTTTCCGCTAGTAAAA RP0413 413 >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Jam More ...
Summary for Structure ((((:[[[[:))))::::::::]]]] - 5 records total
Structure:  ((((:[[[[:)))):::::::]]]]
Organism Sequence ID# ID Notes
EU420138 Bat coronavirus GTGTTATGGAACACGAGCAGTCCAT RP0445 445 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome More ...
EU420138 Bat coronavirus ACCAATGTGATGGTATTTTCACACA RP0446 446 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome More ...
M25381 Feline immunodeficiency virus GCCATTAGAATGGCTAATGTATCTA RP0447 447 >gi|323933|gb|M25381.1|FIVCG Feline immunodeficiency virus complete genome Compu More ...
NC_009597 Pyrococcus abyssi virus CAGGAGCCAGCCTGGTGATAGTGGC RP0449 449 >gi|149274319|ref|NC_009597.1| Pyrococcus abyssi virus 1, complete genome Comput More ...
Summary for Structure ((((:[[[[:)))):::::::]]]] - 4 records total
Page summary 15 - records total

Sequence to Structure Report

Structure:  ((((:[[[[:))))::::::]]]]
Organism Sequence ID# ID Notes
X52374 Berne virus mRNA AACATAATGGTGTTTGGACACATT RP0448 448 >gi|58776|emb|X52374.1| Berne virus mRNA for polymerase Computational James F. L More ...
DQ113897 Adult diarrheal rotavirus TGTAACTATGTACACAGCTAATAG RP0451 451 >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
Summary for Structure ((((:[[[[:))))::::::]]]] - 2 records total
Structure:  ((((:[[[[:)))):::::]]]]
Organism Sequence ID# ID Notes
CY043336 Influenza A virus ATTTTCATTCAAATACGGCAATG RP0450 450 >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme More ...
Summary for Structure ((((:[[[[:)))):::::]]]] - 1 records total
Structure:  ((((:[[[[::))))::::]]]]
Organism Sequence ID# ID Notes
|NM_002467 Homo sapiens AGCCGCCAAGAGGCTAAAGTTGG RP0636 636 >ref|NM_002467.3| Homo sapiens v-myc myelocytomatosis viral oncogene homolog (a More ...
Summary for Structure ((((:[[[[::))))::::]]]] - 1 records total
Structure:  ((((:[[[[[[))))::]]]]]]
Organism Sequence ID# ID Notes
H1N1 HA HM624086 CCCATTGCATTTGGGTAAATGTA RP0643 643 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
Summary for Structure ((((:[[[[[[))))::]]]]]] - 1 records total
Structure:  ((((:[[[[[[:))))::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGC More ... RP0632 632 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((:[[[[[[:))))::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::]]]]]] - 1 records total
Structure:  ((((:[[[[[[:)))):::::::::::::]]]]]]
Organism Sequence ID# ID Notes
AF033818 Bovine leukemia virus TGCCCGGGCCTCGGCAACCGGCCCCCAAAAGGCCC RP0417 417 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
Summary for Structure ((((:[[[[[[:)))):::::::::::::]]]]]] - 1 records total
Structure:  ((((:[[[[[[[)))):::::]]]]]]]
Organism Sequence ID# ID Notes
J02513 bacteriophage T4 TGCCAGCTATGAGGTAAAGTGTCATAGC RP0208 207 PKB-number: PKB74
Definition: Pseudoknot of the regulatory region of T4 bacte More ...
Summary for Structure ((((:[[[[[[[)))):::::]]]]]]] - 1 records total
Structure:  ((((:[[[[[[[))))::]]]]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus AGCTTATTTTGCAGCTGTGTAAGAT RP0673 673 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((:[[[[[[[))))::]]]]]]] - 1 records total
Structure:  ((((:[[[[[[[:::)))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GTGGAGGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATC More ... RP0577 577 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((:[[[[[[[:::)))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::]]]]]]] - 1 records total
Structure:  (((([[[:::::))))]]]
Organism Sequence ID# ID Notes
A04321|HIVLAIJ19 AGTTGTCACCCTAACTGAC RP0007 7 H0007 James F.Lynn 01-08-09 >A04321|HIVLAIJ19 KSNEG
Page summary 11 - records total

Sequence to Structure Report

NC_009597 Pyrococcus abyssi virus GGATTCTATTACATCCAGA RP0333 333 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_003871 Carrot red leaf luteovirus AATCACAAGGGTGATTTGT RP0351 351 method: computational James F. Lynn 10-24-2009 >gi|20889313|ref|NC_003871.1| Car More ...
NC_001653 Hepatitis delta virus GGGGGTTCACACCCCCAAC RP0354 354 method: computational James F. Lynn 10-23-2009 >gi|13277517|ref|NC_001653.2| Hep More ...
NC_001653 Hepatitis delta virus TTACTCTTTTCTGTAAAGA RP0355 355 method: computational James F. Lynn 10-23-2009 >gi|13277517|ref|NC_001653.2| Hep More ...
GU979419 Spissistilus festinus virus GGGGAGGGTTCCCCCCCCT RP0543 543 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus CCTCAATCTGCTGAGGATT RP0544 544 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure (((([[[:::::))))]]] - 7 records total
Structure:  (((([[[:::::::))))]]]
Organism Sequence ID# ID Notes
A07108 HIV GGTCTCTCTGGTTAGACCAGA RP0008 8 >A07108 (appears twice)Human immunodeficiency virus type 1 (LAV.ELI) proviral D More ...
A04321|HIVLAIJ19 AAAATCTTAGAGCCTTTTAGA RP0009 9 >A04321|HIVLAIJ19 James F.Lynn 01-08-09 This motif is found in 100% of HIV1 ge More ...
A04321|HIVLAIJ19 GGTCTCTCTGGTTAGACCAGA RP0010 10 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
X82130 Odontoglossum ringspot virus AATATGTCTTACACTATTACA RP0264 264 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
52352969 ebolavirus TTTATTGTTAAAAATAAACAA RP0386 386 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus TTTAATTGCCGTAATAAAAAT RP0387 387 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
Australian bat lyssavirus AF418014 ATCAGATCAATAGATGATATC RP0435 435 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
GU979419 Spissistilus festinus virus CTTGCTCTTCAGAGCAAGGAG RP0527 527 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus GTGTGACAGGGCTCACACGTC RP0553 553 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure (((([[[:::::::))))]]] - 9 records total
Structure:  (((([[[::::::::))))]]]
Organism Sequence ID# ID Notes
A07108 HIV AAGCTTGCCTTGAGTGCTTCAA RP0011 11 >A07108 (appears twice)James F.Lynn 01-08-09 KSNEG
A04321|HIVLAIJ19 AAGCTTGCCTTGAGTGCTTCAA RP0012 12 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
A04321|HIVLAIJ19 GCTGCCAGAAAAAGACAGCTGG RP0013 13 >A04321|HIVLAIJ19James F.Lynn 01-08-09 RSNEG
DQ113899.1| Adult diarrheal rotavirus AATTATCAACGCGGAAATTGAT RP0282 282 >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computat More ...
NC_009597 Pyrococcus abyssi virus CCGACCGCGAGAGTTTCGGCGG RP0294 294 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_003871 Carrot red leaf luteovirus GCGGCCTCGTAGTGGCCGCAGG RP0348 348 method: computational James F. Lynn 10-24-2009 >gi|20889313|ref|NC_003871.1| Car More ...
NC_007014 Small anellovirus 2 GTTTTGGAAAAGAAGAAACCCA RP0368 368 method: computational James F. Lynn 10-25-09 >gi|66391753|ref|NC_007014.1| Small More ...
NC_003410 Canary circovirus GCAACCGGAGTGACCTTGCCGG RP0374 374 method: computational James F. Lynn 10-25-09 >gi|18875309|ref|NC_003410.1| Canar More ...
NC_001427 Chicken anemia virus GGGGGGGGGCTAAAGCCCCCCC RP0381 381 method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke More ...
52352969 ebolavirus AACTTCCTGGCAATCAGTTGGA RP0408 408 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
52352969 ebolavirus AACTTCCTGGCAATCAGTTGGA RP0383 383 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
Page summary 26 - records total

Sequence to Structure Report

Chayote yellow mosaic virus NC_004618 TTCAGGAAACACTTGTGAATCC RP0440 440 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu More ...
GU979419 Spissistilus festinus virus TCCCTGATATCCAGGGGGATCA RP0555 555 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus GCGTGGGCTGAAGCCACGCCCC RP0554 554 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure (((([[[::::::::))))]]] - 14 records total
Structure:  (((::::::::::::::::[[[[[[[::::))):::::]]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCT RP0587 587 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((::::::::::::::::[[[[[[[::::))):::::]]]]]]] - 1 records total
Structure:  (((:::::::::::[[[[)))::::::::::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 AACTGCCCCCTTCCGGCCGTTCGCGCTCAGCCCGGCC RP0111 111 M0011 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::::::::::[[[[ More ...
Summary for Structure (((:::::::::::[[[[)))::::::::::::]]]] - 1 records total
Structure:  (((::::::[[[[)))::::::::::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 GTCGCCCAGAACCGACGGGGGCTTGATTGGTT RP0110 110 M0010 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((::::::[[[[))):: More ...
Summary for Structure (((::::::[[[[)))::::::::::::]]]] - 1 records total
Structure:  (((:::::[[[)))::::::::::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 HIV TTGCTGCACCTCAATTCTCTCTTTGGAGG RP0146 146 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV CTTAGCACTGAAAGTAGTAAGCGATGTCA RP0147 147 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV CCTCCCCCTCCAGGACTAGCATAAATGGA RP0148 148 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV TAACAAAAGCCTTAGGCATCTCCTATGGC RP0149 149 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV GTAATTAATTGTACAAGACCCAACAACAA RP0150 150 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV TCACTCTCTTGTGAGGGACAGAAATACAA RP0151 151 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
GU979419 Spissistilus festinus virus ACACCCACCCGTGTGTGTTCGGCTTGCGG RP0547 547 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus GGGATTTTCTGCCCAGTGCCCAAAATCAG RP0548 548 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus GTGTCCTGGTGCACTGGAGACGTGGACAC RP0549 549 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus CCTAAGTGGATAGGTGCCAATGCTGCATC RP0550 550 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
GU979419 Spissistilus festinus virus TTGGTTCAGCGCAACCCGGCCCTGCTCGC RP0551 551 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure (((:::::[[[)))::::::::::::]]] - 11 records total
Structure:  (((:::::[[[))):::::::::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 HIV CACTCTATTTTGTGCATCAGATGCTAAA RP0144 144 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV CCAAAGACATTTGGCTGGCTATGGAAAT RP0145 145 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
Summary for Structure (((:::::[[[))):::::::::::]]] - 2 records total
Page summary 19 - records total

Sequence to Structure Report

Structure:  (((:::::[[[)))::::::::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 HIV GACAATCAGTGGTCTTATAAAATTCAC RP0142 142 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV GGACCTCCTCCTCCTCCCCCTCCAGGA RP0143 143 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
Summary for Structure (((:::::[[[)))::::::::::]]] - 2 records total
Structure:  (((:::::[[[))):::::::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 HIV ACCAGAAAAAGGGTGGCTCAGTACTT RP0138 138 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV GGAGCTAATTTTCCAGGTTTGGCAAA RP0139 139 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV TTTATGGGATGAAAGCCTAAAGCCAT RP0140 140 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV GTAATTAATTGTACAAGACCCAACAA RP0141 141 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
Summary for Structure (((:::::[[[))):::::::::]]] - 4 records total
Structure:  (((:::::[[[)))::::::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 HIV AATGCTGATAGATTTTAGGGAACTA RP0136 136 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV ACAGTTTTAATTGTGGAGGGGAATT RP0137 137 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
Summary for Structure (((:::::[[[)))::::::::]]] - 2 records total
Structure:  (((:::::[[[))):::::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 HIV ATAGGAGGTTTTATTAATACTAAA RP0134 134 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF03839 HIV TACAGAAGTTAGTAGGAGTATTAA RP0135 135 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
Summary for Structure (((:::::[[[))):::::::]]] - 2 records total
Structure:  (((:::::[[[)))::::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im ATGATAAATACCATAGTAATGTA RP0129 129 M0030
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im ACTTGAAGGAGAGTGAGAGACTC RP0128 128 M0028
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im AAAACTCAAAATTTAAAAATTTT RP0131 131 M0031
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV ACAGATACTTGTGTTTAATACAA RP0132 132 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
>gi|2828036|gb|AF038398.1|AF038398 HIV GTAATTAATTGTACAAGACCCAA RP0133 133 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
Summary for Structure (((:::::[[[)))::::::]]] - 5 records total
Structure:  (((:::::[[[))):::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im ACACATGCCTGTGTACCCACAG RP0125 125 M0025
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im AATCTGTAGTAATTAATTGTAC RP0126 126 M0026
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im GATGTATAAATATCACTGCATT RP0127 127 M0027
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im CAGAGGATTTGCTGCACCTCAA RP0122 122 M0022
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
Page summary 19 - records total

Sequence to Structure Report

>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im AAAACTCAAAATTTAAAAATTT RP0123 123 M0023
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im TTGTTTCATAACAAAAGCCTTA RP0124 124 M0024
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
AF038398 HIV CCTCCGGTTGCAGGTAAGTGCA RP0121 121 M0021
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
Summary for Structure (((:::::[[[))):::::]]] - 7 records total
Structure:  (((:::::[[[)))::::]]]
Organism Sequence ID# ID Notes
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im CAATTCTCTCTTTGGAGGAGA RP0118 118 M0019
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im CAATTCTCTCTTTGGAGGAGA RP0119 119 M0019
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human im AATGGCAGTTCATTGCATGAA RP0120 120 M0020
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
Summary for Structure (((:::::[[[)))::::]]] - 3 records total
Structure:  (((:::::[[[[)))::::::::::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 TCAGGTGGCGTCTGAAAAGACTCGCCAGACG RP0109 109 M0009 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::::[[[[)))::: More ...
Summary for Structure (((:::::[[[[)))::::::::::::]]]] - 1 records total
Structure:  (((:::::[[[[:))):::::]]]]
Organism Sequence ID# ID Notes
AF033818 Bovine leukemia virus CAGACCCCCTTGACTGACAACCAAG RP0419 419 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
AF033818 Bovine leukemia virus AGCCCATCCCGGCGCTCTCCCCCGG RP0418 418 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
AF033818 Bovine leukemia virus AATATATGGGTAGATTCCAAATACC RP0420 420 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
EU420138 Bat coronavirus TTCTGCTATTGCTGAACCTAAGCAA RP0425 425 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
EU420138 Bat coronavirus ATATGCCTTCGTTTATAGCTTACGA RP0426 426 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
EU420138 Bat coronavirus TCCTAGTATTGATGGATTCTGTCAA RP0427 427 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
EU420138 Bat coronavirus TGAAGATTCCAGTTCAAAGTTCTGG RP0428 428 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
EU420138 Bat coronavirus GGCAACATTTTTGGCCTTTACAAAA RP0429 429 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
EU420138 Bat coronavirus TTCTAAGGTACATGAAGTCATTGTA RP0430 430 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
EU420138 Bat coronavirus AAACACATTACTGTTTTATCAAGTA RP0431 431 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
Summary for Structure (((:::::[[[[:))):::::]]]] - 10 records total
Structure:  (((:::::[[[[:)))::]]]]
Organism Sequence ID# ID Notes
HIV K03455 GCAATTTCACCGGTGCTACGGT RP0605 605 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((:::::[[[[:)))::]]]] - 1 records total
Structure:  (((:::::[[[[[)))::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 CAGAAAAAGACAGCTGGACTGTC RP0600 600 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((:::::[[[[[)))::]]]]] - 1 records total
Page summary 19 - records total

Sequence to Structure Report

Structure:  (((:::::[[[[[[::::)))::]]]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus GCCCTAGCTCTACCACGAGGCACGGTAGA RP0666 666 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure (((:::::[[[[[[::::)))::]]]]]] - 1 records total
Structure:  (((::::[[[)))::::::]]]
Organism Sequence ID# ID Notes
AC183531 Pan troglodytes GAAGAAGTATTTCATCTGATAT RP0301 301 >gb|AC183531.2 Pan troglodytes BAC clone CH251-637O1 from chromosome 2, complet More ...
AC148022 Homo sapiens GAAGAAGTATTTCATCTGATAT RP0302 302 >gb|AC148022.2| Homo sapiens BAC clone RP11-1383G16 from 2, complete sequence More ...
Summary for Structure (((::::[[[)))::::::]]] - 2 records total
Structure:  (((::::[[[[[)))::::::]]]]]
Organism Sequence ID# ID Notes
* GCGATTTCTGACCGCTTTTTTGTCAG RP0211 211 PKB-number: PKB81
Definition: Oligonucleotide PK5
Organism:
Abbreviation: More ...
Summary for Structure (((::::[[[[[)))::::::]]]]] - 1 records total
Structure:  (((::::[[[[[))):::]]]]]
Organism Sequence ID# ID Notes
X78602 peanut clump virus CGCTGAAACGGAGCGATATCCGT RP0076 76 PKB-number: PKB33
Definition: tRNA-like structure 3'end pseudoknot of RNA1 of More ...
L07269 peanut clump virus CGCTGAAACGGAGCGATATCCGT RP0159 159 PKB-number: PKB34
Definition: tRNA-like structure 3'end pseudoknot of RNA2 of More ...
X99149 Indian peanut clump virus CGCCGATACGGAGCGATATCCGT RP0160 160 PKB-number: PKB35
Definition: tRNA-like structure 3'end pseudoknot of RNA-1 o More ...
Z97873 beet soil-borne virus CCCTTTACTTGAGGGAAATCAAG RP0161 161 PKB-number: PKB36
Definition: tRNA-like structure 3'end pseudoknot of RNA 1 o More ...
U64512 beet soil-borne virus CCCTTAACTTGAGGGAAATCAAG RP0162 162 PKB-number: PKB37
Definition: tRNA-like structure 3'end pseudoknot of RNA 2 o More ...
Z66493 beet soil-borne virus CCCTTAACTAGAGGGAAATCTAG RP0163 163 PKB-number: PKB38
Definition: tRNA-like structure 3'end pseudoknot of RNA 3 o More ...
X16378 turnip yellow mosaic virus CCCCTCTTCCGAGGGTCATCGGA RP0084 84 PKB-number: PKB5
Definition: tRNA-like structure from turnip yellow mosaic More ...
J02413 tobacco mosaic virus CCCAAAACCCTGGGGATACAGGG RP0096 96 PKB-number: PKB17
Definition: tRNA-like structure 3'end pseudoknot of cowpea More ...
>A07108 HIV TTAGCCACTTTTTAAAAGAAAAG RP0217 217 >A07108 hiv James F.Lynn 08-09-2009
Summary for Structure (((::::[[[[[))):::]]]]] - 9 records total
Structure:  (((:::[[[:::))):::]]]
Organism Sequence ID# ID Notes
Arabidopsis thaliana mitochondria TCCAGAAGCGCTGGAAGGGCT RP0021 21 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TTAACCTCAGAATAAGATTGA RP0022 22 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TCTAGTAGTCATAGACTCACT RP0023 23 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria AAGCATGTCATGTATATG RP0020 20 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CATTCCATTCTGATGATAAAT RP0019 19 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria AGAGTGTCTCAATCTGGTAGA RP0027 27 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CCCATGGGGACGGGGTAGCCC RP0028 28 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GCCAGCCGCTCGGGCTCCGCG RP0029 29 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Page summary 21 - records total

Sequence to Structure Report

Arabidopsis thaliana mitochondria GAAGGTAACGAATTCTCCGTT RP0030 30 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TGGAAGCCTAAGCCAAGAAGG RP0026 26 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TTTTGACTTCGTAAAAATAAG RP0025 25 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria AGTTAAGTAAAGACTGGTTAC RP0024 24 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GCATCCCTTTCCTGCATAAAG RP0033 33 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CTTGGATTCGAGAAGACGGAA RP0034 34 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GATCATTTCGAGATCTTCGAA RP0035 35 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria ACACTCTCAACTTGTAGATGA RP0032 32 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GCCGCAAAAGGGGGCCGCTTT RP0031 31 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TCAGAGAAGTTTTGACCGCTT RP0036 36 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria ATATCAATATTATATATATAT RP0037 37 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria ATAGGATTAGATCTTTCTTAT RP0038 38 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GCGTACTATGGATCTCTTACG RP0039 39 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GACTCTCCTTTCGTCATAAGG RP0040 40 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CCTTCCAGAACCAGGGGGTCT RP0041 41 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TTATTACTCGACTAAAAGGAG RP0042 42 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CGACTTTGTTCGTCGTGTACA RP0055 55 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GCTATGAAGCTTAGCCTTCTT RP0043 43 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria AGAAACGACATCTCTTATGTC RP0044 44 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CTTTTATTCATGAAGAAAGAA RP0045 45 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GGAGAGGAGTGATCCAAGCTC RP0046 46 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CTTTCCAATAAGAAGATCATT RP0047 47 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TCTTTTTTTTGAAGAAAGAAA RP0048 48 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria ATTTATCATCAGAATGGAATG RP0049 49 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria AACAGACTAGTCGTTCAGTAG RP0050 50 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CAACCGTCTTGATTGAATAGA RP0051 51 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TCTTTCACTATTAGATTCAGT RP0052 52 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria ATATCTATTATTTATAATAAT RP0053 53 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TCTCCTAGAGAAAGAAGTTCT RP0054 54 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CGCTGCCTACACGCGAATTAG RP0056 56 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Page summary 30 - records total

Sequence to Structure Report

Arabidopsis thaliana mitochondria CTCAATATATACGAGTGTTAT RP0057 57 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria ACGTCGGAACCGCGTGAGTTC RP0058 58 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GGGGCTGTTAAGCCCAAGAAC RP0059 59 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GACTCCGCGAACGTCCCGCGC RP0060 60 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GGCATGATCAAAGCCGATGAT RP0061 61 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GCGGCCCATAGGCGCGAGATG RP0062 62 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CCCACAACCAAAGGGAGTGGT RP0063 63 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria GGGTCCGAGCTTCCCAAGCTC RP0064 64 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TTATCTTTAAGATAATGGTAA RP0065 65 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria AAAAAAGGGGGCTTTGTTCCC RP0066 66 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria AAATCGGTACACTTTTAGTAC RP0067 67 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CCCCTTGAAGTAGGGGGTTTC RP0068 68 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CTTGACTGAGCAAAGAAGTCA RP0069 69 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TTAATAATCAAATAATAAGAT RP0070 70 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CTTAGGAAGAAAAAGGCTCTT RP0071 71 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TTGAAAGAAAGACAAAACTTC RP0072 72 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria TGTTCCTCGGATACAATTCGA RP0073 73 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria CTTTCGGGCGAGAAGCAGGCC RP0074 74 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Arabidopsis thaliana mitochondria ACCAGTTCATATTTGGTTACT RP0075 75 >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
Summary for Structure (((:::[[[:::))):::]]] - 57 records total
Structure:  (((:::[[[[)))::::::::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 GGTGCGAGAAACCATTCATTCTGTTCT RP0108 108 M0008 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::: More ...
Summary for Structure (((:::[[[[)))::::::::::]]]] - 1 records total
Structure:  (((:::[[[[))):::::::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 GGTGGCTAGGACCTCTCCCGGCCCTA RP0107 107 M0007 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::: More ...
Summary for Structure (((:::[[[[))):::::::::]]]] - 1 records total
Structure:  (((:::[[[[)))::::::]]]]
Organism Sequence ID# ID Notes
X02144 tobacco mosaic virus AAAGTTTGTGTTTCTAAAACACA RP0212 212 PKB-number: PKB82
Definition: Pseudoknot PK1 of the upstream pseudoknot domai More ...
Summary for Structure (((:::[[[[)))::::::]]]] - 1 records total
Page summary 22 - records total

Sequence to Structure Report

Structure:  (((:::[[[[))):::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 GGGACCCTGACCCAACAATCAG RP0105 105 M0005 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::] More ...
Bovine Leukemia Virus AF033818 GGTGCGAGAAACCATTCATTCT RP0106 106 M0006 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::] More ...
AF033820 Equine infectious anemia virus TACCAACTTTGTAAAAGAAAAG RP0115 115 M0015
AF033820 Equine infectious anemia virus
James F. Lynn 12-25-08

(((:: More ...
AP000545 Homo sapiens ATATTTTTATTATTATTAATAA RP0222 222 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens ATATTAAAAATATTCACCTTTT RP0224 224 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TATAAGTAATATAATAATATTA RP0223 223 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens CTCTGAAATTGAGGCAATAATT RP0227 227 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TATTTCATATATATGTAAATAT RP0225 225 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens AAAGATACTCTTTGAGAGGAGT RP0226 226 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
DQ192570 Crow polyomavirus AGCAGGATATGCTAACAGATAT RP0269 269 >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational J More ...
CY043336.1| Influenza A virus TTTGTGGTGTAAACAGTGACAC RP0279 279 >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme More ...
DQ113897.1| Adult diarrheal rotavirus GAAGAAATATTTCATCTGATAT RP0288 288 >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
NC_009597 Pyrococcus abyssi virus TTTATGAGAAAAAGCTCTTTCT RP0293 293 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_009597 Pyrococcus abyssi virus TTAATATAACTAATTTTGGTTA RP0291 291 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_009597 Pyrococcus abyssi virus AAAAGAGAAGTTTGACGCCTTC RP0292 292 method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
NC_013116 Sclerotinia sclerotiorum hypovirulence a CCAAGGCTTCTGGCCCAAGAAG RP0336 336 method: computational James F. Lynn 10-23-2009 >gi|256352170|ref|NC_013116.1| Sc More ...
NC_012958 Drosophila A virus TCGAAGAGGGCGAAATCGCCCT RP0344 344 method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr More ...
NC_002068 Bovine circovirus GTATTCTGATTACCAGCAATCA RP0373 373 method: computational James F. Lynn 10-25-09 >gi|9631282|ref|NC_002068.1| Bovine More ...
52352969 ebolavirus CATCGGTATAATGATCAGTATA RP0388 388 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
Australian bat lyssavirus AF418014 AATCTCATCCATTTCGTGGGAT RP0432 432 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
Eupatorium yellow vein virus AB433979 AATCTCATCCATTTCGTGGGAT RP0436 436 >gi|195963299|dbj|AB433979.1| Eupatorium yellow vein virus- [Japan: Kagawa: Toma More ...
Eupatorium yellow vein virus AB433979 TTGACTTGGTCAATTGGTACCA RP0437 437 >gi|195963299|dbj|AB433979.1| Eupatorium yellow vein virus- [Japan: Kagawa: Toma More ...
GU979419 Spissistilus festinus virus GCATTTGTAGTGCGCGCCCTAC RP0524 524 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
FM865409 Homo sapiens neanderthalensis AACCTTTTAAGTTAAAGATTAA RP0568 568 >gi|253947317|emb|FM865409.1| Homo sapiens neanderthalensis complete mitochondri More ...
FM865411 Homo sapiens neanderthalensis AACCTTTTAAGTTAAAGATTAA RP0564 564 >gi|253947345|emb|FM865411.1| Homo sapiens neanderthalensis complete mitochondri More ...
FM865410 Homo sapiens neanderthalensis AACCTTTTAAGTTAAAGATTAA RP0566 566 >gi|253947331|emb|FM865410.1| Homo sapiens neanderthalensis complete mitochondri More ...
NC_012920 Homo sapiens mitochondrion AACCTTTTAAGTTAAAGATTAA RP0570 570 >gi|251831106|ref|NC_012920.1| Homo sapiens mitochondrion, complete genome 16569 More ...
FM865408 Homo sapiens neanderthalensis AACCTTTTAAGTTAAAGATTAA RP0571 571 >gi|253947303|emb|FM865408.1| Homo sapiens neanderthalensis complete mitochondri More ...
NC_011137 Homo sapiens neanderthalensis AACCTTTTAAGTTAAAGATTAA RP0573 573 >gi|196123578|ref|NC_011137.1| Homo sapiens neanderthalensis mitochondrion, comp More ...
Summary for Structure (((:::[[[[))):::::]]]] - 29 records total
Page summary 29 - records total

Sequence to Structure Report

Structure:  (((:::[[[[)))::::]]]]
Organism Sequence ID# ID Notes
Bovine Leukemia Virus AF033818 CCCTGTCAGTGGGGCTCACTG RP0104 104 M0004 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[)))::::]] More ...
Summary for Structure (((:::[[[[)))::::]]]] - 1 records total
Structure:  (((:::[[[[))):::]]]]
Organism Sequence ID# ID Notes
M25782 satellite tobacco mosaic virus CCCTAACCGCGGGTAAGCGG RP0077 77 PKB-number: PKB22 Definition: tRNA-like structure 3'end pseudoknot of satellit More ...
X72586 paprika mild mottle virus CCTTTACCCCGGGTATGGGG RP0079 79 PKB-number: PKB24 Definition: tRNA-like structure 3'end pseudoknot of paprika More ...
X82130.1 Odontoglossum ringspot virus CGTTGTGTACACGATAGTAC RP0190 190 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
X82130.1 Odontoglossum ringspot virus CGTGGTGCATACGATAATGC RP0191 191 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
AY729654 Sudan ebolavirus GAGGGATTTTCTCAGGAAAA RP0468 468 >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 More ...
AF418014 Australian bat lyssavirus ATCTCCGAAGGATTATCTTC RP0469 469 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
Summary for Structure (((:::[[[[))):::]]]] - 6 records total
Structure:  (((:::[[[[)))::]]]]
Organism Sequence ID# ID Notes
M34077 tobacco mild green mosaic virus CCGTAACCGCCGGTAGCGG RP0078 78 PKB-number: PKB23 Definition: tRNA-like structure 3'end pseudoknot of tobacco More ...
M81413 pepper mild mottle virus CCCGAACCGCGGGTAGCGG RP0154 154 PKB-number: PKB27
Definition: tRNA-like structure 3'end pseudoknot of pepper More ...
X02144 tobacco mosaic virus CCGGAACCCCCGGTTGGGG RP0100 100 PKB-number: PKB21
Definition: tRNA-like structure 3'end pseudoknot of the tom More ...
J02415 tobacco mosaic virus CCGTTACCCCCGGTAGGGG RP0097 97 PKB-number: PKB18
Definition: tRNA-like structure 3'end pseudoknot of tobacco More ...
X72587 pepper mild mottle virus CCCGAACCGCGGGTAGCGG RP0098 98 PKB-number: PKB19
Definition: tRNA-like structure 3'end pseudoknot of pepper More ...
D12505 cucumber green mottle mosaic virus CCTTTTCCCCGGGTAGGGG RP0099 99 PKB-number: PKB20
Definition: tRNA-like structure 3'end pseudoknot of cucumbe More ...
Summary for Structure (((:::[[[[)))::]]]] - 6 records total
Structure:  (((:::[[[[:))):::::]]]]
Organism Sequence ID# ID Notes
AP000545 Homo sapiens CTTAAGCTGATAAGCAACTTCAG RP0243 243 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens CTTAAGCTGATAAGCAACTTCAG RP0244 244 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens CCCCAGAAAATGGGTTTTCTTTT RP0245 245 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens ATTAAAATTTCAATGAATAAAAT RP0246 246 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens AATAATTTAAAATTGAAATTTAA RP0248 248 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TTTAAATTTTAAAAGCATCAAAA RP0247 247 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens GGCATGAAATTGCCTTAAAATTT RP0249 249 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens AACATCTTTTTGTTGCAGAAAAA RP0250 250 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens ATTTGATGAAGAATGAATATTCA RP0251 251 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
Summary for Structure (((:::[[[[:))):::::]]]] - 9 records total
Page summary 22 - records total

Sequence to Structure Report

Structure:  (((:::[[[[::))):::::]]]]
Organism Sequence ID# ID Notes
AP000545 Homo sapiens TTTGCTTTAATAAAAATTCCTTAA RP0230 230 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TTAACTTTGGAGTAAAAAGTCCAA RP0231 231 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens ATTGTAAATAAAAATAAATGTATT RP0232 232 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TCTCAAATAATAAGAGCTATTTAT RP0233 233 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
Summary for Structure (((:::[[[[::))):::::]]]] - 4 records total
Structure:  (((:::[[[[::)))]]]]
Organism Sequence ID# ID Notes
X82130.1 Odontoglossum ringspot virus CCCTTACCTCGGGTAGAGG RP0196 196 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
Summary for Structure (((:::[[[[::)))]]]] - 1 records total
Structure:  (((:::[[[[:::))):::::]]]]
Organism Sequence ID# ID Notes
AP000545 Homo sapiens GGAAACACAACATTCCAAAGCTTGT RP0234 234 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens ATATTTTTATTATTATTAATAATAA RP0235 235 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TTTAGGAAAATAAAAAACATATTTT RP0236 236 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens CTCTTGAACCCAGGAGGCAGAGGTT RP0237 237 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
Summary for Structure (((:::[[[[:::))):::::]]]] - 4 records total
Structure:  (((:::[[[[::::))):::::]]]]
Organism Sequence ID# ID Notes
AP000545 Homo sapiens TTAAATTTTAGACCTAAAACCATAAA RP0252 252 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TTAAATTTTAGACCTAAAACCATAAA RP0253 253 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TGAAACTTTTCCAATCAATAGAAAAA RP0254 254 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens CTGGAGTGGAACTCCAGCAAACTCCA RP0255 255 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens CTTTTAATAAATTTAAGACGCTTTAT RP0256 256 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TATTGTAAATAAAAATAAATGTATTT RP0257 257 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TAAATATTTTCTCCTTAAAACTAAAA RP0258 258 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens GCTTTGTTATATTCAGCAAAATATAA RP0259 259 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TTTTGCTTTAATAAAAATTCCTTAAA RP0260 260 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens TTAAATTATATTAATAAATTTTTATA RP0261 261 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens AATTTAAAATTGAAATTTAAATATTT RP0263 263 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
AP000545 Homo sapiens GGCAGATTTAATCAGCCAGAATTAAA RP0262 262 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
Summary for Structure (((:::[[[[::::))):::::]]]] - 12 records total
Page summary 21 - records total

Sequence to Structure Report

Structure:  (((:::[[[[[))):::::::]]]]]
Organism Sequence ID# ID Notes
X52374 Berne virus TGTGCACCAACACATAGACTTGTTGG RP0219 219 >gi|58776|emb|X52374.1| Berne virus mRNA for polymerase TGTGCACCAACACATAGACTTGT More ...
Summary for Structure (((:::[[[[[))):::::::]]]]] - 1 records total
Structure:  (((:::[[[[[))):::]]]]]
Organism Sequence ID# ID Notes
L07937 soil-borne wheat mosaic virus CCCGAACCGGAGGGTTATCCGG RP0157 157 PKB-number: PKB30
Definition: tRNA-like structure 3'end pseudoknot of RNA1 of More ...
X81639 soil-borne wheat mosaic virus CCCCATCCGGAGGGTTATCCGG RP0158 158 PKB-number: PKB31 Definition: tRNA-like structure 3'end pseudoknot of RNA2 of More ...
AJ223596 beet virus Q CCCTAACTTGAGGGAAATCAAG RP0164 164 PKB-number: PKB39
Definition: tRNA-like structure 3'end pseudoknot of RNA 1 o More ...
AJ223597 beet virus Q CCCTAACTTGAGGGAAATCAAG RP0165 165 PKB-number: PKB40
Definition: tRNA-like structure 3'end pseudoknot of RNA 2 o More ...
AJ223598 CCCTAACTTGAGGGAAATCAAG RP0166 166 PKB-number: PKB41
Definition: tRNA-like structure 3'end pseudoknot of RNA 3 o More ...
AF035633 wild cucumber mosaic virus CCTCCCCCCGTAGGTTAACGGG RP0091 91 PKB-number: PKB12 Definition: tRNA-like structure 3'end pseudoknot of wild cuc More ...
Summary for Structure (((:::[[[[[))):::]]]]] - 6 records total
Structure:  (((:::[[[[[:::)))]]]]]
Organism Sequence ID# ID Notes
X82130.1 Odontoglossum ringspot virus AAAGGACGATCTTTCGCGATCG RP0194 194 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
X82130.1 Odontoglossum ringspot virus GGTGCAGTATAACCCGTTATAC RP0195 195 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
Summary for Structure (((:::[[[[[:::)))]]]]] - 2 records total
Structure:  (((:::[[[[[[))):::]]]]]]
Organism Sequence ID# ID Notes
AF035199 kennedya yellow mosaic virus CGTCTATCCTGGACGTCACCAGGA RP0085 85 PKB-number: PKB6
Definition: tRNA-like structure 3'end pseudoknot of kenned More ...
AF035201 desmodium yellow mottle virus CGTCTATCCTGGACGTCACCAGGA RP0088 88 PKB-number: PKB9
Definition: tRNA-like structure 3'end pseudoknot of desmodiu More ...
AF035200 clitoria yellow vein virus CGTCCATCTCGAACGTCATCGAGA RP0090 90 PKB-number: PKB11
Definition: tRNA-like structure 3'end pseudoknot of clitori More ...
U91413 calopogonium yellow vein virus CGTCTATCCTGAACGTCATCAGGA RP0092 92 PKB-number: PKB13 Definition: tRNA-like structure 3'end pseudoknot of calopogo More ...
AF035202 okra mosaic virus CGCCCATCTCGAGCGTCATCGAGA RP0095 95 PKB-number: PKB16
Definition: tRNA-like structure 3'end pseudoknot of okra mo More ...
AF035198 Kennedya yellow mosaic virus CGTCTATCCTGAACGTCATCAGGA RP0562 562 >gb|AF035198.1| Kennedya yellow mosaic virus strain Port Douglas virion protein More ...
Summary for Structure (((:::[[[[[[))):::]]]]]] - 6 records total
Structure:  (((:::[[[[[[)))::]]]]]]
Organism Sequence ID# ID Notes
J04375 ononis yellow mosaic virus CCCCTTTTCCGAGGGTATCGGAA RP0089 89 PKB-number: PKB10
Definition: tRNA-like structure 3'end pseudoknot of ononis More ...
>A07108 HIV AGTACACATCCCACTAGGGGATG RP0218 218 >A07108 HIV James F.Lynn 08-09-2009
NC_010319 Abaca bunchy top virus GGCTAACTTCCTGCCGAAGGAAG RP0456 456 >gi|167006434|ref|NC_010319.1| Abaca bunchy top virus DNA-R, complete genome Com More ...
NC_010317 Abaca bunchy top virus ATATGCAAAGTATATAATACTTT RP0458 458 >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com More ...
Summary for Structure (((:::[[[[[[)))::]]]]]] - 4 records total
Structure:  (((:::[[[[[[:))):::::::::::::::::::::::::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGGCTAATTCACTCCCAACGAAGACAAGATATCCTTGATCTGTGGAT RP0574 574 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Page summary 20 - records total

Sequence to Structure Report

Summary for Structure (((:::[[[[[[:))):::::::::::::::::::::::::]]]]]] - 1 records total
Structure:  (((:::[[[[[[[:)))::]]]]]]]
Organism Sequence ID# ID Notes
NC_007013 Small anellovirus 1 GCAAAAAACATTGCTGCCACAATGTT RP0367 367 method: computational James F. Lynn 10-25-09 >gi|66391749|ref|NC_007013.1| Small More ...
AB290924 Torque teno midi virus GCAAAAAACATTGCTGCCACAATGTT RP0452 452 >dbj|AB290924.1| Torque teno midi virus ORF1 gene for hypothetical protein, par More ...
AY622911 Small anellovirus GCAAAAAACATTGCTGCCACAATGTT RP0453 453 >gb|AY622911.1| Small anellovirus 1 genomic sequence Length=372 James F. Lynn 0 More ...
AB290918 Torque teno midi virus GCAAAAAACATTGCTGCCACGATGTT RP0454 454 >dbj|AB290918.1| Torque teno midi virus 1 DNA, complete genome, isolate: MD1-07 More ...
Summary for Structure (((:::[[[[[[[:)))::]]]]]]] - 4 records total
Structure:  (((::[[[)))::]]]
Organism Sequence ID# ID Notes
X82130 Odontoglossum ringspot virus AACTTTAGGTTTCCTA RP0188 188 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, movemen More ...
X82130 Odontoglossum ringspot virus AAAGGGGTTTTTAACC RP0189 189 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, movemen More ...
NC_010319 Abaca bunchy top virus CCCTGCCCGGGACGGG RP0455 455 >gi|167006434|ref|NC_010319 Abaca bunchy top virus DNA-R, complete genome Comput More ...
AY729654 Sudan ebolavirus AATCCCCCATTTGGGG RP0470 470 >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
AY729654 Sudan ebolavirus CATAATTCATGCAGAA RP0471 471 >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
AY729654 Sudan ebolavirus CATCAGTGATGGCCAC RP0472 472 >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
AY729654 Sudan ebolavirus ATGTCAATCATTTATT RP0474 474 >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
AY729654 Sudan ebolavirus TTCAATATGAAATATA RP0473 473 >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
AY729654 Sudan ebolavirus TTCCACTAGAATCTAG RP0475 475 >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
AY729654 Sudan ebolavirus AAGAGATTCTTCAAAT RP0476 476 >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
AY729654 Sudan ebolavirus AAAAATATTTTAAATA RP0477 477 >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
AF009606 Hepatitis C virus AGTCCCTCACTGAGAG RP0478 478 >gi|2316097|gb|AF009606 AF009606 Hepatitis C virus Computational James F. Lynn 0 More ...
AF038398 Simian-Human HIV CTAGCAGGTAGAGCCT RP0479 479 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain S More ...
AF038398 Simian-Human HIV GGTTTTCTACCCCAGA RP0480 480 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain S More ...
AF038398 Simian-Human HIV CATCTCCTATGGCAGG RP0481 481 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain S More ...
AF038398 Simian-Human HIV CTAGCAGGTAGAGCCT RP0482 482 >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain S More ...
AF218039 Cricket paralysis virus CAACAGTTTTGACAAC RP0483 483 >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James F More ...
AF218039 Cricket paralysis virus CATTTATCATGAAGAT RP0484 484 >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James F More ...
AF218039 Cricket paralysis virus ATTTCGAAAATATTTC RP0485 485 >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James F More ...
AF218039 Cricket paralysis virus TCACACATTGAAAATG RP0486 486 >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James F More ...
AF253314 Homo sapiens AGACAGAGTCTCTCTC RP0487 487 >gi|10945419|gb|AF253314.1|AF253314 Homo sapiens pheromone receptor (PHB4C5) ps More ...
AP000545 Homo sapiens TTTAATTCAAATTGAA RP0488 488 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
Page summary 26 - records total

Sequence to Structure Report

AP000545 Homo sapiens CCCGCTGCGGGCAGCA RP0489 489 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens CAGGCCTGCTGGCCAG RP0490 490 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens CACTTTAAGTGGATTA RP0491 491 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens AGATTGAGTCTTGCTC RP0492 492 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens TTTAATAAAAATGTTA RP0493 493 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens TATAATCTATATTAGA RP0495 495 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens TGAGCACTTCAATAGT RP0494 494 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens CTATAAAATAGATTTT RP0496 496 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens TTGACGCCCAACTGGC RP0497 497 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens CAGTAAAACTGTATTT RP0498 498 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens ATACCAAATATCTTTT RP0499 499 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens AAATTATATTTCATAT RP0500 500 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens ATATCTATTATCTATA RP0501 501 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens CCAGAAAATGGGTTTT RP0502 502 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens GCTTCAATAGCCAATT RP0503 503 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens TCAGTGATTGAAGATC RP0504 504 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens TTTTTTGAAAAGATCA RP0505 505 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens AAGCATTCCTTTTGAA RP0506 506 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AP000545 Homo sapiens CTTTGCTAAAGCATAG RP0507 507 >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
AF418014 Australian bat lyssavirus GGTTTATAACCACTAT RP0508 508 >gi|22726511|gb|AF418014 Australian bat lyssavirus, complete genome Computationa More ...
AF418014 Australian bat lyssavirus GCTACAACAGCACGTT RP0509 509 >gi|22726511|gb|AF418014 Australian bat lyssavirus, complete genome Computationa More ...
Summary for Structure (((::[[[)))::]]] - 43 records total
Structure:  (((::[[[:)))::::::::::]]]
Organism Sequence ID# ID Notes
A07108 HIV ATTAAATAAAATAGTAAGAATGTAT RP0004 4 >A07108 H0004 James F.Lynn 01-06-09 KSNEG
A07108 HIV ACAAGGAACTGTATCCTTTAACTTC RP0005 5 >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 More ...
A07108 HIV AAGTTGTCCCTTTGACTGACACGAC RP0006 6 >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn More ...
Summary for Structure (((::[[[:)))::::::::::]]] - 3 records total
Structure:  (((::[[[[)))::]]]]
Organism Sequence ID# ID Notes
U03387 turnip vein-clearing virus CCTAACCCCGGGTAGGGG RP0152 152 PKB-number: PKB25
Definition: tRNA-like structure 3'end pseudoknot of turnip More ...
U30944 oilseed rape mosaic virus CCTAACCCCGGGTAGGGG RP0153 153 PKB-number: PKB26
Definition: tRNA-like structure 3'end pseudoknot of oilseed More ...
Page summary 26 - records total

Sequence to Structure Report

U34586 odontoglossum ringspot virus CCTTACCTCGGGTAGAGG RP0155 155 PKB-number: PKB28
Definition: tRNA-like structure 3'end pseudoknot of odontog More ...
D38444 tobacco mosaic virus CCTAACCCCGGGTAGGGG RP0156 156 PKB-number: PKB29
Definition: tRNA-like structure 3'end pseudoknot of tobacco More ...
X82130 Odontoglossum ringspot virus GGATGCAAATCCCATTTG RP0187 187 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, movemen More ...
Summary for Structure (((::[[[[)))::]]]] - 5 records total
Structure:  (((::[[[[:)))::::::]]]]
Organism Sequence ID# ID Notes
HIV K03455 CCTGTGTGGAAGGAAGCAACCAC RP0617 617 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((::[[[[:)))::::::]]]] - 1 records total
Structure:  (((::[[[[:)))::::]]]]
Organism Sequence ID# ID Notes
GU979419 Spissistilus festinus virus AGCCTGGGCTGCTCTGCGCTC RP0556 556 >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
Summary for Structure (((::[[[[:)))::::]]]] - 1 records total
Structure:  (((::[[[[[:)))::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TAGACAAGGAACTGTATCCTT RP0591 591 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((::[[[[[:)))::]]]]] - 1 records total
Structure:  (((::[[[[[:::)))]]]]]
Organism Sequence ID# ID Notes
X82130.1 Odontoglossum ringspot virus CGTTGTGTACACGATAGTACA RP0192 192 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
X82130.1 Odontoglossum ringspot virus CGTGGTGCATACGATAATGCA RP0193 193 >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
Summary for Structure (((::[[[[[:::)))]]]]] - 2 records total
Structure:  (((::[[[[[[))):::]]]]]
Organism Sequence ID# ID Notes
J04374 eggplant mosaic virus CCCCCTCCCGTGGGTCAACGGGA RP0094 94 PKB-number: PKB15
Definition: tRNA-like structure 3'end pseudoknot of eggplan More ...
Summary for Structure (((::[[[[[[))):::]]]]] - 1 records total
Structure:  (((::[[[[[[))):::]]]]]]
Organism Sequence ID# ID Notes
X54354 cacao yellow mosaic virus CGTCCTCCCGAACGTCATCGGGA PK0086 86 PKB-number: PKB7 Definition: tRNA-like structure 3'end pseudoknot of cacao y More ...
Summary for Structure (((::[[[[[[))):::]]]]]] - 1 records total
Structure:  (((::[[[[[[)))::]]]]]]
Organism Sequence ID# ID Notes
D30753 potato mop-top virus CCCCCCTTGGAGGGTATCCAAG RP0130 130 PKB-number: PKB32
Definition: tRNA-like structure 3'end pseudoknot of RNA2 of More ...
Y16104 physalis mottle virus CCCCCTTCCGTGGGTAACGGAA PK0087 87 PKB-number: PKB8
Definition: tRNA-like structure 3'end pseudoknot of physal More ...
AF035402 andean potato latent virus CCCCCTCCTGTGGGCTACAGGA RP0093 93 PKB-number: PKB14
Definition: tRNA-like structure 3'end pseudoknot of andean More ...
J02413 tobacco mosaic virus AGTTTGGTCGTACTTAACGACC RP0215 215 PKB-number: PKB85
Definition: Pseudoknot PK1 of the upstream pseudoknot domai More ...
Summary for Structure (((::[[[[[[)))::]]]]]] - 4 records total
Page summary 14 - records total

Sequence to Structure Report

Structure:  (((:[[[[))):::::]]]]
Organism Sequence ID# ID Notes
J02415 tobacco mosaic virus GGATTGTGTCCGTAATCACA RP0178 178 PKB-number: PKB53 Definition: Pseudoknot PK1 of the upstream pseudoknot domain More ...
HIV K03455 CGCAGGGGGTGGGAAGCCCT RP0625 625 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((:[[[[))):::::]]]] - 2 records total
Structure:  (((:[[[[[)))::]]]]]
Organism Sequence ID# ID Notes
Y16104 physalis mottle virus CCCTTCCGTGGGTAACGGA RP0513 513 Y16104 physalis mottle virus Computational James F. Lynn 06/05/2010 KSPOS
AF035402 andean potato latent virus CCCTCCTGTGGGCTACAGG RP0514 514 AF035402 andean potato latent virus Computational James F. Lynn 06/05/2010 KSPOS
Summary for Structure (((:[[[[[)))::]]]]] - 2 records total
Structure:  (((:[[[[[:)))::]]]]]
Organism Sequence ID# ID Notes
00302 Avian sarcoma virus CACCCCAGGCGTGATTCTGG RP0641 641 (((:[[[[[:)))::]]]]] or (((:[[[[::))):::]]]] with GU pair CACCCCAGGCGTGATTCTGG K More ...
AY350569 Avian leukosis virus CACCCCAGACGTGATTCTGG RP0640 640 >gi|493011|gb|M10455.1|ACSUR2CG UR2 sarcoma virus, complete genome 3166 bp KSPOS More ...
K03377 Rous sarcoma virus CACCCCAGACGTGGTTCTGG RP0642 642 >gb|K03377.1|ALRGENVM Rous sarcoma virus (transformation defective B77 strain) More ...
Summary for Structure (((:[[[[[:)))::]]]]] - 3 records total
Structure:  (((:[[[[[::::::)))::::]]]]]
Organism Sequence ID# ID Notes
H1N1 HA HM624086 GCAGGGGTCAGGATATGCAGCCGACCT RP0646 646 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
Summary for Structure (((:[[[[[::::::)))::::]]]]] - 1 records total
Structure:  (((:[[[[[[)))::::::::::::::::::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCT RP0622 622 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((:[[[[[[)))::::::::::::::::::]]]]]] - 1 records total
Structure:  (((:[[[[[[))):::]]]]]]
Organism Sequence ID# ID Notes
J02415 tobacco mosaic virus CGTGGTGCGTACGATAACGCAT RP0179 179 PKB-number: PKB54 Definition: Pseudoknot PK2 of the upstream pseudoknot domain More ...
U34586 odontoglossum ringspot virus CGTGGTGCATACGATAATGCAT RP0184 184 PKB-number: PKB59 Definition: Pseudoknot PK2 of the upstream pseudoknot domain More ...
U34586 odontoglossum ringspot virus CGTTGTGTACACGATAGTACAT RP0186 186 PKB-number: PKB61 Definition: Pseudoknot PK2 of the upstream pseudoknot domain More ...
U34586 odontoglossum ringspot virus CGTTGTGTACACGATAGTACAT RP0202 202 PKB-number: PKB61
Definition: Pseudoknot PK2 of the upstream pseudoknot domai More ...
U34586 odontoglossum ringspot virus CGTGGTGCATACGATAATGCAT RP0204 204 PKB-number: PKB63
Definition: Pseudoknot PK2 of the upstream pseudoknot domai More ...
X02144 tobacco mosaic virus CGTGGTACGTACGATAACGTAC RP0213 213 PKB-number: PKB83
Definition: Pseudoknot PK2 of the upstream pseudoknot domai More ...
Summary for Structure (((:[[[[[[))):::]]]]]] - 6 records total
Structure:  (((:[[[[[[[[:))):::::::::::::::::::::::::::::::]]]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATCCATTTT RP0613 613 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((:[[[[[[[[:))):::::::::::::::::::::::::::::::]]]]]]]] - 1 records total
Page summary 16 - records total

Sequence to Structure Report

Structure:  (((:[[[[[[[[:)))::]]]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 ATGGTTTTATAGACATCACTATGAAA RP0607 607 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((:[[[[[[[[:)))::]]]]]]]] - 1 records total
Structure:  ((:(((:::::[[[:::))):)):::]]]
Organism Sequence ID# ID Notes
AF033818 Bovine leukemia virus GGTGGTTCTCGGCTGAGACCGCCGCGAGC RP0415 415 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
EU420138 Bat coronavirus GTACTGGCTTCTTTTGTCAGGACCCAAAA RP0424 424 >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
Summary for Structure ((:(((:::::[[[:::))):)):::]]] - 2 records total
Structure:  ((:[[[[::))):::::]]]]
Organism Sequence ID# ID Notes
NM_002467 Homo sapiens GCTGCCAAGAGGCTAAAGTTGG RP0638 638 >ref|NM_002467.3| Homo sapiens v-myc myelocytomatosis viral oncogene homolog (av More ...
Summary for Structure ((:[[[[::))):::::]]]] - 1 records total
Structure:  (:((((:::::[[[::)))):):::]]]
Organism Sequence ID# ID Notes
X52374 Berne virus GGTGTTAATTTAGGTGAACATCAAGCCT RP0274 274 >gi|58776|emb|X52374.1| Berne virus mRNA for polymerase Computational James F. More ...
AF033818 Bovine leukemia virus TTTCAGACCCCCTTGACTGACAACCAAG RP0275 275 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational More ...
X13063 Turnip yellows virus GGTTTATTGCTCAATATAAAACAATTTG RP0276 276 >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA Computationa More ...
Summary for Structure (:((((:::::[[[::)))):):::]]] - 3 records total
Page summary 7 - records total
Global summary 674 - records total