Sequence to Structure Report

Structure:  NULL
Organism Sequence ID# ID Notes
RP0648 648
Summary for Structure NULL - 1 records total
Structure:  (((((((((((::(((:::[[[[[)))::))))::::)))))))::::::::::]]]]]
Organism Sequence ID# ID Notes
U68074 E.coli CCTCTCTCCCTAGCCTCCGCTCTTAGGACGGGGATCAAGAGAGGTCAAACCCAAAAGAG RP0175 175 PKB-number: PKB50 Definition: Pseudoknot PK2 of E.coli tmRNA Organism: E.coli More ...
Summary for Structure (((((((((((::(((:::[[[[[)))::))))::::)))))))::::::::::]]]]] - 1 records total
Structure:  ((((((((((:(((:[[[:[[[))):)))))))))):::::::::]]]:]]]
Organism Sequence ID# ID Notes
U68074 E.coli GTTTGTTAGTGGCGTGTCCGTCCGCAGCTGGCAAGCGAATGTAAAGACTGAC RP0177 177 PKB-number: PKB52 Definition: Pseudoknot PK4 of E.coli tmRNA Organism: E.coli More ...
Summary for Structure ((((((((((:(((:[[[:[[[))):)))))))))):::::::::]]]:]]] - 1 records total
Structure:  ((((((((((::::::::[[[[[[[[[::::))))))))))::::]]]]]]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus AAAATGTAAATATTATTTCATTTTTAACTGCTTTGCGTTTTATGTTTAAAGGTG RP0664 664 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((((((::::::::[[[[[[[[[::::))))))))))::::]]]]]]]]] - 1 records total
Structure:  ((((((((((:[[[[)))))))))):::::]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus GGGGTAATAACTTGTTTGTTACCTTTTTGGATAA RP0672 672 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((((((:[[[[)))))))))):::::]]]] - 1 records total
Structure:  (((((((((::[[[[)))))))))::]]]]
Organism Sequence ID# ID Notes
HIV K03455 GTTATCTATCAATACATGGATGATTTGTAT RP0598 598 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((((::[[[[)))))))))::]]]] - 1 records total
Structure:  (((((((((:[[[[[::::::)))))))))::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTC RP0590 590 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((((:[[[[[::::::)))))))))::::]]]]] - 1 records total
Structure:  (((((((((:[[[[[[))))))))):::::::::::::::::::]]]]]]
Organism Sequence ID# ID Notes
C. botulinum NC_010520 AATAAGAGGCTTTGTATCTCTTATTGAATCTTTAGTAATAGGCATACAAA RP0657 657 viral read though like KSPOS J.Lynn 04/19/2011
Summary for Structure (((((((((:[[[[[[))))))))):::::::::::::::::::]]]]]] - 1 records total
Structure:  ((((((((:::[[)))))))):::::]]
Organism Sequence ID# ID Notes
HIV K03455 TGGTGCTACAAGCTAGTACCAGTTGAGC RP0576 576 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
HIV K03455 TGGTGCTACAAGCTAGTACCAGTTGAGC RP0631 631 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((((:::[[)))))))):::::]] - 2 records total
Structure:  ((((((((::[[[[[:::::::::::::))))))))::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGAC RP0618 618 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((((::[[[[[:::::::::::::))))))))::]]]]] - 1 records total
Structure:  ((((((((::[[[[[[[)))))))):::::::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
M26927 gibbon ape leukemia virus GGGTTCGGACCCCCTCCCCGAACCTAGGGTAACACTGACTGUGGAGGGG RP0209 209 PKB-number: PKB79
Definition: Gag/pol translational readthrough site of gibbo More ...
Summary for Structure ((((((((::[[[[[[[)))))))):::::::::::::::::]]]]]]] - 1 records total
Structure:  ((((((((::[[[[[[[)))))))):::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
C. botulinum NC_010520 AATTACTTTTATTATTTAAGTAATTTGGCTTTTTATATAAATAAT RP0658 658 viral read though like KSPOS J.Lynn 04/19/2011
Summary for Structure ((((((((::[[[[[[[)))))))):::::::::::::]]]]]]] - 1 records total
Structure:  ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
AF033811 Moloney murine leukemia virus GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGC RP0172 172 PKB-number: PKB47 Definition: Gag/pol translational readthrough site of Molone More ...
J01998 AKV murine leukemia virus GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCACTGTCGGGGGGC RP0208 208 PKB-number: PKB78
Definition: Gag/pol translational readthrough site of AKV m More ...
Summary for Structure ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]] - 2 records total
Structure:  (((((((:::::::::::[[[[))))))):::]]]]
Organism Sequence ID# ID Notes
HIV K03455 GTCAACATAATTGGAAGAAATCTGTTGACTCAGATT RP0594 594 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((:::::::::::[[[[))))))):::]]]] - 1 records total
Structure:  (((((((::::::[[[[[[[[))))))):::::::::::::::::]]]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGG RP0612 612 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::::::[[[[[[[[))))))):::::::::::::::::]]]]]]]] - 1 records total
Structure:  (((((((:::::[[[:)))))))::]]]
Organism Sequence ID# ID Notes
HIV K03455 CTTGCTGAAGCGCGCACGGCAAGAGGCG RP0581 581 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((:::::[[[:)))))))::]]] - 1 records total
Structure:  (((((((::::[[[[((((:::::((((((((:::::))))))))))))))))))):::::::]]]]
Organism Sequence ID# ID Notes
J02415 tobacco mosaic virus TGTGTCTTGGATCGCGCGGGTCAAATGTATATGGTTCATATACATCCGCAGGCACGTAATAAAGCGA RP0182 182 PKB-number: PKB57 Definition: tRNA-like structure bulge pseudoknot of tobacco More ...
Summary for Structure (((((((::::[[[[((((:::::((((((((:::::))))))))))))))))))):::::::]]]] - 1 records total
Structure:  (((((((::::[[[[[)))))))::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TGTTCCTTGGGTTCTTGGGAGCAGCAGGAA RP0621 621 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::::[[[[[)))))))::]]]]] - 1 records total
Structure:  (((((((::::[[[[[[::)))))))::::::::]]]]]]
Organism Sequence ID# ID Notes
AF033818 Bovine leukemia virus AGTGGGTCTCTAGGGGCACACCCACTACCCGCCGGCCCCT RP0421 421 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
Summary for Structure (((((((::::[[[[[[::)))))))::::::::]]]]]] - 1 records total
Structure:  (((((((::::[[[[[[::::))))))):::::::::::::::::::::::::::::::::::::::]]]]]]
Organism Sequence ID# ID Notes
HIV K03455 GTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGG RP0610 610 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::::[[[[[[::::))))))):::::::::::::::::::::::::::::::::::::::]]]]]] - 1 records total
Structure:  (((((((::[[[))))))):::]]]
Organism Sequence ID# ID Notes
HIV K03455 TTGAGAGACTTACTCTTGATTGTAA RP0624 624 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::[[[))))))):::]]] - 1 records total
Structure:  (((((((::[[[::::))))))):::::::::::]]]
Organism Sequence ID# ID Notes
HIV K03455 TTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCT RP0589 589 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure (((((((::[[[::::))))))):::::::::::]]] - 1 records total
Structure:  (((((((:[[)))))))::]]
Organism Sequence ID# ID Notes
NC_010317 Abaca bunchy top virus GGCTTCCTGCGGAAGCCAGGC RP0459 459 >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com More ...
Summary for Structure (((((((:[[)))))))::]] - 1 records total
Structure:  ((((((:(::[[[[[[[):))))))::::::::::::::::::]]]]]]]
Organism Sequence ID# ID Notes
M54993 spleen necrosis virus GGGTTCTCCCGCCCTCCGTGAACCCAGGCTAAAAGTTAAGGTAGGGGGGC RP0173 173 PKB-number: PKB48 Definition: Gag/pol translational readthrough site of spleen More ...
Summary for Structure ((((((:(::[[[[[[[):))))))::::::::::::::::::]]]]]]] - 1 records total
Structure:  ((((((:::::::::::::::::[[[[[::::::::))))))::::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 TTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCC RP0629 629 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:::::::::::::::::[[[[[::::::::))))))::::]]]]] - 1 records total
Structure:  ((((((:::::::[[[[:::::)))))):::]]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus TGTACAAGATATATACCGTTCATGTGCACAAGGTG RP0667 667 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((:::::::[[[[:::::)))))):::]]]] - 1 records total
Structure:  ((((((::::::[[))))))::::]]
Organism Sequence ID# ID Notes
AF033818 Bovine leukemia virus GGGGGGACTTAGCGCCCCCCAAACCG RP0416 416 >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
X13063 Turnip yellows virus ACTCAGTATTGTGCCTGAGTGATGGC RP0423 423 >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA Computationa More ...
Summary for Structure ((((((::::::[[))))))::::]] - 2 records total
Structure:  ((((((:::::[[[))))))::::]]]
Organism Sequence ID# ID Notes
AF033818 Bovine Leukemia Virus GGGGGGACTTAGCGCCCCCCAAACCGT RP0080 80 PKB-number: PKB1 Definition: Gag/pro ribosomal frameshift site of Bovine Leuke More ...
X13063 Turnip yellows virus ACTCAGTATTGTGCCTGAGTGATGGCA RP0101 101 >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA12-25-08 Jame More ...
Chayote yellow mosaic virus NC_004618 CCACACAAATAATTGTGTGGTCCCAAT RP0441 441 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu More ...
Summary for Structure ((((((:::::[[[))))))::::]]] - 3 records total
Structure:  ((((((:::::[[[[[:))))))::]]]]]
Organism Sequence ID# ID Notes
HIV K03455 CTGGGGATTTGGGGTTGCTCTGGAAAACTC RP0623 623 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
Summary for Structure ((((((:::::[[[[[:))))))::]]]]] - 1 records total
Structure:  ((((((::::[[[))))))::]]]
Organism Sequence ID# ID Notes
NC_016157 Human papillomavirus GGCATCACACACAGATGCTGATGT RP0669 669 >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
Summary for Structure ((((((::::[[[))))))::]]] - 1 records total
Page summary 35 - records total
Global summary 674 - records total