Main Database, View record [ ID: 99 ]
ID# RP0099 
ID 99 
Sequence CCTTTTCCCCGGGTAGGGG 
Structure (((:::[[[[)))::]]]] 
Organism D12505 cucumber green mottle mosaic virus 
Notes PKB-number: PKB20
Definition: tRNA-like structure 3'end pseudoknot of cucumber green mottle mosaic virus
Organism: cucumber green mottle mosaic virus
Abbreviation: CGMMV
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: D12505
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes: 3 4
3 0 2
Position Paired:
6402-6404; 6412-6414
6408-6411; 6417-6420
Bracket view of structure:
6390 6400 6410 6420
# 789|123456789|123456789|123456789|1234
$ 6387 GGGGUUCGAAUCCCCCCUUUUCCCCGGGUAGGGGCCCA=6424
% 6387 :::::::::::::::(((:::[[[[)))::]]]]::::