Main Database, View record [ ID: 98 ]
ID# RP0098 
ID 98 
Sequence CCCGAACCGCGGGTAGCGG 
Structure (((:::[[[[)))::]]]] 
Organism X72587 pepper mild mottle virus 
Notes PKB-number: PKB19
Definition: tRNA-like structure 3'end pseudoknot of pepper mild mottle virus (Italian strain)
Organism: pepper mild mottle virus
Abbreviation: PMMV-I
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: X72587
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes: 3 4
3 0 2
Position Paired:
677-679; 687-689
683-686; 692-695
Bracket view of structure:
670 680 690
# 23456789|123456789|123456789|123456789
$ 662 GGGGUUCGAAUCCCCCCCGAACCGCGGGUAGCGGCCCA=699
% 662 :::::::::::::::(((:::[[[[)))::]]]]::::