Main Database, View record [ ID: 97 ]
ID# RP0097 
ID 97 
Sequence CCGTTACCCCCGGTAGGGG 
Structure (((:::[[[[)))::]]]] 
Organism J02415 tobacco mosaic virus 
Notes PKB-number: PKB18
Definition: tRNA-like structure 3'end pseudoknot of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: J02415
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] Rietveld K et al., EMBO J.1984, 3:2613-2619.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Comment: This is the most extensively studied representative structure from tobamoviruses.
The sequence is given for the so-called "strain vulgare".
Stem sizes:
Loop sizes: 3 4
3 0 2
Position Paired:
6373-6375; 6383-6385
6379-6382; 6388-6391
Bracket view of structure:
6360 6370 6380 6390
# 89|123456789|123456789|123456789|12345
$ 6358 GGGGUUCGAAUCCCCCCGUUACCCCCGGUAGGGGCCCA=6395
% 6358 :::::::::::::::(((:::[[[[)))::]]]]::::