Main Database, View record [ ID: 96 ]
ID# RP0096 
ID 96 
Sequence CCCAAAACCCTGGGGATACAGGG 
Structure (((::::[[[[[))):::]]]]] 
Organism J02413 tobacco mosaic virus 
Notes PKB-number: PKB17
Definition: tRNA-like structure 3'end pseudoknot of cowpea strain of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: CcTMV
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end; aminoacylation
EMBL number: J02413
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324
Comment: The 3'end of this tobamoviral RNA has structural similarity to the tymoviral structures and, in contrast to histidine-accepting tobamoviruses, is charged with valine.
This virus is also called: sunhemp mosaic virus (SHMV).
Stem sizes:
Loop sizes: 3 5
4 0 3
Position Paired:
1774-1776; 1786-1788
1781-1785; 1792-1796
Bracket view of structure:
1760 1770 1780 1790 1800
# 9|123456789|123456789|123456789|123456789|
$ 1759 GGGGAGCAUUACCCCCCCAAAACCCUGGGGAUACAGGGCCCA=1800
% 17