Main Database, View record [ ID: 95 ]
ID# RP0095 
ID 95 
Sequence CGCCCATCTCGAGCGTCATCGAGA 
Structure (((:::[[[[[[))):::]]]]]] 
Organism AF035202 okra mosaic virus 
Notes PKB-number: PKB16
Definition: tRNA-like structure 3'end pseudoknot of okra mosaic virus
Organism: okra mosaic virus
Abbreviation: OMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: AF035202
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes: 3 6
3 0 3
Position Paired:
655-657; 667-669
661-666; 673-678
Bracket view of structure:
640 650 660 670 680
# |123456789|123456789|123456789|123456789|1
$ 640 GGGGUGCAACUCCCCCGCCCAUCUCGAGCGUCAUCGAGACCA=681
% 640 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::