Main Database, View record [ ID: 94 ]
ID# RP0094 
ID 94 
Sequence CCCCCTCCCGTGGGTCAACGGGA 
Structure (((::[[[[[[))):::]]]]] 
Organism J04374 eggplant mosaic virus 
Notes PKB-number: PKB15
Definition: tRNA-like structure 3'end pseudoknot of eggplant mosaic virus
Organism: eggplant mosaic virus
Abbreviation: EMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: J04374
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324
Stem sizes:
Loop sizes: 3 6
2 0 3
Position Paired:
6305-6307; 6316-6318
6310-6315; 6322-6327
Bracket view of structure:
6300 6310 6320 6330
# 123456789|123456789|123456789|123456789|1
$ 6291 UGGGUGCGACUCCCCCCCCUCCCGUGGGUCAACGGGAACCA=6331
% 6291 ::::::::::::::(((::[[[[[[))):::]]]]]]::::