Main Database, View record [ ID: 92 ]
ID# RP0092 
ID 92 
Sequence CGTCTATCCTGAACGTCATCAGGA 
Structure (((:::[[[[[[))):::]]]]]] 
Organism U91413 calopogonium yellow vein virus 
Notes PKB-number: PKB13 Definition: tRNA-like structure 3'end pseudoknot of calopogonium yellow vein virus Organism: calopogonium yellow vein virus Abbreviation: CaYVV RNA type: Viral tRNA-like Keywords: tymoviruses; RNA 3'end EMBL number: U91413 Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) Supported by: Sequence comparison References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. Stem sizes: Loop sizes: 3 6 3 0 3 Position Paired: 670-672; 682-684 676-681; 688-693 Bracket view of structure: 660 670 680 690 # 56789|123456789|123456789|123456789|123456 $ 655 GGGGUGCGACUCCCCCGUCUAUCCUGAACGUCAUCAGGACCA=696 % 655 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::KSPOS