Main Database, View record [ ID: 91 ]
ID# RP0091 
ID 91 
Sequence CCTCCCCCCGTAGGTTAACGGG 
Structure (((:::[[[[[))):::]]]]] 
Organism AF035633 wild cucumber mosaic virus 
Notes PKB-number: PKB12 Definition: tRNA-like structure 3'end pseudoknot of wild cucumber mosaic virus Organism: wild cucumber mosaic virus Abbreviation: WCMV RNA type: Viral tRNA-like Keywords: tymoviruses; RNA 3'end EMBL number: AF035633 Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) Supported by: Sequence comparison References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. Stem sizes: Loop sizes: 3 5 3 0 3 Position Paired: 1354-1356; 1365-1367 1360-1364; 1371-1375 Bracket view of structure: 1340 1350 1360 1370 # |123456789|123456789|123456789|123456789 $ 1340 CGGGUGCAACCCCCCCUCCCCCCGUAGGUUAACGGGACCA=1379 % 1340 ::::::::::::::(((:::[[[[[))):::]]]]]::::KSPOS