Main Database, View record [ ID: 90 ]
ID# RP0090 
ID 90 
Sequence CGTCCATCTCGAACGTCATCGAGA 
Structure (((:::[[[[[[))):::]]]]]] 
Organism AF035200 clitoria yellow vein virus 
Notes PKB-number: PKB11
Definition: tRNA-like structure 3'end pseudoknot of clitoria yellow vein virus
Organism: clitoria yellow vein virus
Abbreviation: CYVV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: AF035200
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes: 3 6
3 0 3
Position Paired:
633-635; 645-647
639-644; 651-656
Bracket view of structure:
620 630 640 650
# 89|123456789|123456789|123456789|123456789
$ 618 UGGGUGCAACCCCCCCGUCCAUCUCGAACGUCAUCGAGACCA=659
% 618 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::