Main Database, View record [ ID: 9 ]
ID# RP0009 
ID
Sequence AAAATCTTAGAGCCTTTTAGA 
Structure (((([[[:::::::))))]]] 
Organism A04321|HIVLAIJ19 
Notes >A04321|HIVLAIJ19 James F.Lynn 01-08-09 This motif is found in 100% of HIV1 genomes KSNEG