Main Database, View record [ ID: 89 ]
ID# RP0089 
ID 89 
Sequence CCCCTTTTCCGAGGGTATCGGAA 
Structure (((:::[[[[[[)))::]]]]]] 
Organism J04375 ononis yellow mosaic virus 
Notes PKB-number: PKB10
Definition: tRNA-like structure 3'end pseudoknot of ononis yellow mosaic virus
Organism: ononis yellow mosaic virus
Abbreviation: OYMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: J04375
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes: 3 6
3 0 2
Position Paired:
6186-6188; 6198-6200
6192-6197; 6203-6208
Bracket view of structure:
6180 6190 6200 6210
# 23456789|123456789|123456789|123456789|1
$ 6172 UGGGUUCAACUCCCCCCCUUUUCCGAGGGUAUCGGAAACC=6211
% 6172 ::::::::::::::(((:::[[[[[[)))::]]]]]]:::