Main Database, View record [ ID: 88 ]
ID# RP0088 
ID 88 
Sequence CGTCTATCCTGGACGTCACCAGGA 
Structure (((:::[[[[[[))):::]]]]]] 
Organism AF035201 desmodium yellow mottle virus 
Notes PKB-number: PKB9
Definition: tRNA-like structure 3'end pseudoknot of desmodium yellow mottle virus
Organism: desmodium yellow mottle virus
Abbreviation: DYMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: AF035201
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324
Stem sizes:
Loop sizes: 3 6
3 0 3
Position Paired:
662-664; 674-676
668-673; 680-685
Bracket view of structure:
650 660 670 680
# 789|123456789|123456789|123456789|12345678
$ 647 GGGGUGCAACUCCCCCGUCUAUCCUGGACGUCACCAGGACCA=688
% 647 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::