Main Database, View record [ ID: 87 ]
ID# PK0087 
ID 87 
Sequence CCCCCTTCCGTGGGTAACGGAA 
Structure (((::[[[[[[)))::]]]]]] 
Organism Y16104 physalis mottle virus 
Notes PKB-number: PKB8
Definition: tRNA-like structure 3'end pseudoknot of physalis mottle virus
Organism: physalis mottle virus
Abbreviation: PhyMV
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: Y16104
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes: 3 6
2 0 2
Position Paired:
6648-6650; 6659-6661
6653-6658; 6664-6669
Bracket view of structure:
6640 6650 6660 6670
# 456789|123456789|123456789|123456789|123
$ 6634 UGGGUGCAACUCCCCCCCCUUCCGUGGGUAACGGAAACCA=6673
% 6634 ::::::::::::::(((::[[[[[[)))::]]]]]]::::