Main Database, View record [ ID: 86 ]
ID# PK0086 
ID 86 
Sequence CGTCCTCCCGAACGTCATCGGGA 
Structure (((::[[[[[[))):::]]]]]] 
Organism X54354 cacao yellow mosaic virus 
Notes PKB-number: PKB7 Definition: tRNA-like structure 3'end pseudoknot of cacao yellow mosaic virus Organism: cacao yellow mosaic virus Abbreviation: CaYMV RNA type: Viral tRNA-like Keywords: tymoviruses; RNA 3'end EMBL number: X54354 Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) Supported by: Sequence comparison References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. Stem sizes: Loop sizes: 3 6 2 0 3 Position Paired: 656-658; 667-669 661-666; 673-678 Bracket view of structure: 640 650 660 670 680 # |123456789|123456789|123456789|123456789|1 $ 640 GGUGGUGCAACUCCCCCGUCCUCCCGAACGUCAUCGGGACCA=681 % 640 ::::::::::::::::(((::[[[[[[))):::]]]]]]:::KSPOS