Main Database, View record [ ID: 85 ]
ID# RP0085 
ID 85 
Sequence CGTCTATCCTGGACGTCACCAGGA 
Structure (((:::[[[[[[))):::]]]]]] 
Organism AF035199 kennedya yellow mosaic virus 
Notes PKB-number: PKB6
Definition: tRNA-like structure 3'end pseudoknot of kennedya yellow mosaic virus (strain Bawley Point)
Organism: kennedya yellow mosaic virus
Abbreviation: KYMV-BP
RNA type: Viral tRNA-like
Keywords: tymoviruses; RNA 3'end
EMBL number: AF035199
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes: 3 6
3 0 3
Position Paired:
626-628; 638-640
632-637; 644-649
Bracket view of structure:
620 630 640 650
# 123456789|123456789|123456789|123456789|12
$ 611 GGGGUGCAACUCCCCCGUCUAUCCUGGACGUCACCAGGACCA=652
% 611 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::