Main Database, View record [ ID: 83 ]
ID# RP0083 
ID 83 
Sequence GGGGCGAGCTGCAGCCCCAGTGAATCAAATGCAGC 
Structure (((((::[[[[[[))))):::::::::::]]]]]] 
Organism M25381 Feline Immunodeficiency Virus 
Notes PKB-number: PKB4 Definition: Gag-pol ribosomal frameshift site of Feline Immunodeficiency Virus Organism: Feline Immunodeficiency Virus Abbreviation: FIV RNA type: Viral ribosomal frameshifting Keywords: retroviridae; ribosomal frameshift; gag-pol EMBL number: M25381 Submitted by: J. Ng ( JackTown@Hotmail.com) Supported by: Sequence comparison References: [1] ten Dam E., Pleij C.W.A., & Bosch L.(1990). Virus Genes 4, 121-136. [2] Talbot et al.(1989). Proc.Natl.Acad.Sci.USA 86, 5743-5747. [3] Phillips,T.R. et al. (1990). J.Virol. 64, 4605-4613. Comment: The sequence below is given for so-called Petaluma isolate [2]. In the PPR-isolate [3], the A at position 1921 is substituted by G (EMBL accession number M36968). Stem sizes: Loop sizes: 5 6 2 0 11 Position Paired: 1893-1897; 1906-1910 1900-1905; 1922-1927 Bracket view of structure: 1880 1890 1900 1910 1920 # 89|123456789|123456789|123456789|1234567 KSPOS