Main Database, View record [ ID: 82 ]
ID# RP0082 
ID 82 
Sequence GGGGCTCAAGGGAGGCCCCAGAAACAAACTTTCCC 
Structure ((((((:::[[[[))))))::::::::::::]]]] 
Organism AF033820 Equine Infectious Anemic Virus 
Notes PKB-number: PKB3 Definition: Gag-pol ribosomal frameshift site of Equine Infectious Anemia Virus Organism: Equine Infectious Anemic Virus Abbreviation: EIAV RNA type: Viral ribosomal frameshifting Keywords: retroviridae; ribosomal frameshift; gag-pol EMBL number: AF033820 Submitted by: J. Ng ( JackTown@Hotmail.com) Supported by: Sequence comparison References: [1] ten Dam E., Pleij C.W.A., & Bosch L.(1990). Virus Genes 1990, 4, 121-136. [2] Stephens,R.M., et al.(1986). Science 231, 589-594. Stem sizes: Loop sizes: 6 4 3 0 12 Position Paired: 1797-1802; 1810-1815 1806-1809; 1828-1831 Bracket view of structure: 1790 1800 1810 1820 1830 # 123456789|123456789|123456789|123456789|123456789|1234 $ 1781 AAAAAACGGGAAGCAAGGGGCUCAAGGGAGGCCCCAGAAACAAACUUUCCCGAU=1834 % 1781 ::::::::::::::::[[[[[[:::((((]]]]]]::::::::::::))))::: ((((((:{{[[[[))))))::::::::::}}]]]] KSPOS