Main Database, View record [ ID: 81 ]
ID# RP0081 
ID 81 
Sequence CGCGGCACCGTCCGCGGAACAAACGG 
Structure (((((::[[[[)))))::::::]]]] 
Organism X13063 Beet Western-Yellows Virus 
Notes PKB-number: PKB2 Modification: 1999-6-21 Definition: Orf2-orf3 ribosomal frameshift site of Beet Western Yellows Virus Organism: Beet Western-Yellows Virus Abbreviation: BWYV RNA type: Viral ribosomal frameshifting Keywords: luteoviridae; ribosomal frameshift; orf2-orf3 EMBL number: X13063 Submitted by: J. Ng ( JackTown@Hotmail.com) Supported by: Sequence comparison; mutagenesis; crystal structure References: [1] Garcia,A., van Duin,J. & Pleij,C.W.A.(1993). Nucleic Acids.Res. 21, 401-406. [2] Veidt,I. et al.(1988). Nucleic Acids Res 16, 9917-9932. [3] Su,L., Chen,L., Egli,M., Berger,J.M. & Rich,A.(1999). Nature Struct. Biol. 6, 285-292. Comment: According to crystal structure [3], the residue U1576 is bulged out whereas A1588 is tilted and forms H-bonds with bases in different layers at the stem junction. Stem sizes: Loop sizes: 5 4 2 0 6 Position Paired: 1566-1570; 1577-1581 1573-1576; 1588-1591 Bracket view of structure: