Main Database, View record [ ID: 80 ]
ID# RP0080 
ID 80 
Sequence GGGGGGACTTAGCGCCCCCCAAACCGT 
Structure ((((((:::::[[[))))))::::]]] 
Organism AF033818 Bovine Leukemia Virus 
Notes PKB-number: PKB1 Definition: Gag/pro ribosomal frameshift site of Bovine Leukemia Virus Organism: Bovine Leukemia Virus Abbreviation: BLV RNA type: Viral ribosomal frameshifting Keywords: retroviridae; ribosomal frameshift; gag-pro EMBL number: AF033818 Submitted by: J. Ng ( JackTown@Hotmail.com) Supported by: Sequence comparison References: [1] ten Dam,E., Pleij,C.W.A. & Bosch,L.(1990). Virus Genes 4, 121-136. [2] Sagata,N. et al.(1985). Proc.Natl.Acad.Sci.USA 82, 677-681. [3] Rice,N.R. et al.(1985). Virology 142, 357-377. Stem sizes: Loop sizes: 6 3 5 0 4 Position Paired: 1604-1609; 1618-1623 1615-1617; 1628-1630 Bracket view of structure: 1590 1600 1610 1620 1630 # |123456789|123456789|123456789|123456789|123456 $ 1590 AAAAAACUAAUAGAGGGGGGACUUAGCGCCCCCCAAACCGUAACCCC=1636 % 1590 ::::::::::::::[[[[[[:::::(((]]]]]]::::))):::::: 1604-1631 end of GAG ((((((::{{:[[[)))))):}}:]]] KSPOS