Main Database, View record [ ID: 8 ]
ID# RP0008 
ID
Sequence GGTCTCTCTGGTTAGACCAGA 
Structure (((([[[:::::::))))]]] 
Organism A07108 HIV 
Notes >A07108 (appears twice)Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 01-08-09 KSNEG