Main Database, View record [ ID: 79 ]
ID# RP0079 
ID 79 
Sequence CCTTTACCCCGGGTATGGGG 
Structure (((:::[[[[))):::]]]] 
Organism X72586 paprika mild mottle virus 
Notes PKB-number: PKB24 Definition: tRNA-like structure 3'end pseudoknot of paprika mild mottle virus Organism: paprika mild mottle virus Abbreviation: PaMMV RNA type: Viral tRNA-like Keywords: tobamovirus; RNA 3'end EMBL number: X72586 Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) Supported by: Sequence comparison References: [1] Garcia-Luque I et al. Arch.Virol.1993, 131:75-88. [2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. Comment: Initially the virus was termed as P11 strain or Dutch isolate of pepper mild mottle virus (PMMV), but the term for a new virus paprika mild mottle virus (PaMMV) was proposed [1] on the basis of sequence comparisons. Stem sizes: Loop sizes: 3 4 3 0 3 Position Paired: 817-819; 827-829 823-826; 833-836 Bracket view of structure: 810 820 830 840 # 23456789|123456789|123456789|123456789| $ 802 GGGGUUCGAAUCCCCCCUUUACCCCGGGUAUGGGGCCCA=840 (((:{{[[[[)))}}:]] KSPOS