Main Database, View record [ ID: 77 ]
ID# RP0077 
ID 77 
Sequence CCCTAACCGCGGGTAAGCGG 
Structure (((:::[[[[))):::]]]] 
Organism M25782 satellite tobacco mosaic virus 
Notes PKB-number: PKB22 Definition: tRNA-like structure 3'end pseudoknot of satellite tobacco mosaic virus Organism: satellite tobacco mosaic virus Abbreviation: STMV RNA type: Viral tRNA-like Keywords: satellite virus; RNA 3'end; aminoacylation EMBL number: M25782 Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) Supported by: Sequence comparison; aminoacylation assays References: [1] Gultyaev AP, van Batenburg E, Pleij CWA. J.Gen.Virol. 1994, 75:2851-2856. [2] Felden B, Florentz C, McPherson A, Giege R. Nucleic Acids Res. 1994, 22:2882-2886. Stem sizes: Loop sizes: 3 4 3 0 3 Position Paired: 1035-1037; 1045-1047 1041-1044; 1051-1054 Bracket view of structure: 1020 1030 1040 1050 # |123456789|123456789|123456789|12345678 $ 1020 GGGGUUCGAAUCCCUCCCUAACCGCGGGUAAGCGGCCCA=1058 % 1020 :::::::::::::::(((:::[[[[))):::]]]]:::: ((({::[[[[)))::}]]]]KSPOS