Main Database, View record [ ID: 76 ]
ID# RP0076 
ID 76 
Sequence CGCTGAAACGGAGCGATATCCGT 
Structure (((::::[[[[[))):::]]]]] 
Organism X78602 peanut clump virus 
Notes PKB-number: PKB33
Definition: tRNA-like structure 3'end pseudoknot of RNA1 of peanut clump virus
Organism: peanut clump virus
Abbreviation: PCV1
RNA type: Viral tRNA-like
Keywords: furovirus; 3'end; aminoacylation
EMBL number: X78602
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; aminoacylation assays
References: [1] Herzog E et al., J.Gen.Virol. 1994, 75:3147-3155.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178.
Stem sizes:
Loop sizes: 3 5
4 0 3
Position Paired:
5871-5873; 5883-5885
5878-5882; 5889-5893
Bracket view of structure:
5860 5870 5880 5890
# 89|123456789|123456789|123456789|1234567
$ 5858 GGUGCAAAUCCCCCGCUGAAACGGAGCGAUAUCCGUCCCA=5897
% 5858 :::::::::::::(((::::[[[[[))):::]]]]]::::