Main Database, View record [ ID: 68 ]
ID# RP0068 
ID 68 
Sequence CCCCTTGAAGTAGGGGGTTTC 
Structure (((:::[[[:::))):::]]] 
Organism Arabidopsis thaliana mitochondria 
Notes >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31; last updated: 2005-04-05 366924 bp. Arabidopsis thaliana Computationally discovered structures by James F. Lynn ~March, 2009