Main Database, View record [ ID: 62 ]
ID# RP0062 
ID 62 
Sequence GCGGCCCATAGGCGCGAGATG 
Structure (((:::[[[:::))):::]]] 
Organism Arabidopsis thaliana mitochondria 
Notes >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31; last updated: 2005-04-05 366924 bp. Arabidopsis thaliana Computationally discovered structures by James F. Lynn ~March, 2009 rp0062 very common analogs (((:::[[[:::))):::]]] GCGGCCCATAGGCGCGAGATG >gb|GQ220326.1| Vitis vinifera strain PN40024 mitochondrion >gb|EU431224.1| Carica papaya mitochondrion >gb|FJ374974.1| Solanum lycopersicum mitochondrial >emb|FM179380.1| Vitis vinifera complete mitochondrial >gb|AC145156.61| Medicago truncatula clone mth2-7h6 >dbj|BA000042.1| Nicotiana tabacum mitochondrial DNA >gb|AC007729.3| Arabidopsis thaliana chromosome 2 BAC T18C6 >dbj|AP006444.1| Brassica napus mitochondrial DNA >dbj|BA000009.3| Beta vulgaris subsp. vulgaris mitochondrial DNA method: computational linguistic plus MSA BLAST James F. Lynn 08-04-2009