Main Database, View record [ ID: 6 ]
ID# RP0006 
ID
Sequence AAGTTGTCCCTTTGACTGACACGAC 
Structure (((::[[[:)))::::::::::]]] 
Organism A07108 HIV 
Notes >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 01-06-09 KSNEG