Main Database, View record [ ID: 4 ]
ID# RP0004 
ID
Sequence ATTAAATAAAATAGTAAGAATGTAT 
Structure (((::[[[:)))::::::::::]]] 
Organism A07108 HIV 
Notes >A07108 H0004 James F.Lynn 01-06-09 KSNEG