Main Database, View record [ ID: 21 ]
ID# RP0021 
ID 21 
Structure (((:::[[[:::))):::]]] 
Organism Arabidopsis thaliana mitochondria 
Notes >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31; last updated: 2005-04-05 366924 bp. Arabidopsis thaliana Computationally discovered structures by James F. Lynn ~March, 2009 KSPOS UCCAGAAGCGCUGGAAGGGCU (((((.[[[.)))))...]]] Energy calculated by pknotsRG: -10.1 kcal/mol