Main Database, View record [ ID: 16 ]
ID# RP0016 
ID 16 
Sequence GGAATTTGGAATTCCCTACAATCCCCA 
Structure ((((::[[[::)))):::::::::]]] 
Organism A07108 HIV 
Notes >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 01-08-09 KSNEG