Main Database, View record [ ID: 14 ]
ID# RP0014 
ID 14 
Sequence GATTGTTTTTCAGAATCTGCTATAAGAAA 
Structure ((((:::[[[:::)))):::::::::]]] 
Organism A07108 HIV 
Notes >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 01-08-09 KSNEG