Main Database, View record [ ID: 12 ]
ID# RP0012 
ID 12 
Sequence AAGCTTGCCTTGAGTGCTTCAA 
Structure (((([[[::::::::))))]]] 
Organism A04321|HIVLAIJ19 
Notes >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG