Main Database, View record [ ID: 11 ]
ID# RP0011 
ID 11 
Sequence AAGCTTGCCTTGAGTGCTTCAA 
Structure (((([[[::::::::))))]]] 
Organism A07108 HIV 
Notes >A07108 (appears twice)James F.Lynn 01-08-09 KSNEG