Main Database, View record [ ID: 100 ]
ID# RP0100 
ID 100 
Sequence CCGGAACCCCCGGTTGGGG 
Structure (((:::[[[[)))::]]]] 
Organism X02144 tobacco mosaic virus 
Notes PKB-number: PKB21
Definition: tRNA-like structure 3'end pseudoknot of the tomato strain of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV-L
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: X02144
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324.
Stem sizes:
Loop sizes: 3 4
3 0 2
Position Paired:
6362-6364; 6372-6374
6368-6371; 6377-6380
Bracket view of structure:
6350 6360 6370 6380
# 789|123456789|123456789|123456789|1234
$ 6347 GGGAUUCGAAUUCCCCCGGAACCCCCGGUUGGGGCCCA=6384
% 6347 :::::::::::::::(((:::[[[[)))::]]]]::::